| Title: | Toolkit of Helper Functions to Pre-Process Amplification Data |
|---|---|
| Description: | A collection of functions to pre-process amplification curve data from polymerase chain reaction (PCR) or isothermal amplification reactions. Contains functions to normalize and baseline amplification curves, to detect both the start and end of an amplification reaction, several smoothers (e.g., LOWESS, moving average, cubic splines, Savitzky-Golay), a function to detect false positive amplification reactions and a function to determine the amplification efficiency. Quantification point (Cq) methods include the first (FDM) and second approximate derivative maximum (SDM) methods (calculated by a 5-point-stencil) and the cycle threshold method. Data sets of experimental nucleic acid amplification systems ('VideoScan HCU', capillary convective PCR (ccPCR)) and commercial systems are included. Amplification curves were generated by helicase dependent amplification (HDA), ccPCR or PCR. As detection system intercalating dyes (EvaGreen, SYBR Green) and hydrolysis probes (TaqMan) were used. For more information see: Roediger et al. (2015) <doi:10.1093/bioinformatics/btv205>. |
| Authors: | Stefan Roediger [cre, aut] (ORCID: <https://orcid.org/0000-0002-1441-6512>), Michal Burdukiewicz [aut] (ORCID: <https://orcid.org/0000-0001-8926-582X>), Konstantin A. Blagodatskikh [ctb], Andrej-Nikolai Spiess [ctb] (ORCID: <https://orcid.org/0000-0002-9630-4724>) |
| Maintainer: | Stefan Roediger <[email protected]> |
| License: | GPL-3 |
| Version: | 1.0 |
| Built: | 2026-06-02 07:26:45 UTC |
| Source: | https://github.com/pcruniversum/chippcr |
A toolkit of functions to pre-process
amplification curve data. Amplification data can be obtained from
conventional PCR reactions or isothermal amplification reactions. Contains functions to normalize and baseline amplification curves,
a routine to detect the start of an amplification reaction, several
smoothers for amplification data, a function to distinguish positive and
negative amplification reactions and a function to determine the
amplification efficiency. The smoothers are based on LOWESS, moving
average, cubic splines, Savitzky-Golay and others. In addition the first
approximate approximate derivative maximum (FDM) and second approximate
derivative maximum (SDM) can be calculated by a 5-point-stencil as
quantification points from real-time amplification curves. chipPCR
contains data sets of experimental nucleic acid amplification systems
including the 'VideoScan' 'HCU' and a capillary convective PCR (ccPCR) system.
The amplification data were generated by helicase dependent amplification
(HDA) or polymerase chain reaction (PCR) under various temperature
conditions. As detection system intercalating dyes (EvaGreen, SYBR Green)
and hydrolysis probes (TaqMan) were used.
The latest source code is available via:
https://github.com/PCRuniversum/chipPCR
| Package: | chipPCR |
| Type: | Package |
| Version: | 0.0.8-12 |
| Date: | 2017-06-22 |
| License: | GPL-3 |
bg.max can be used to remove missing
values in amplification curve data. amptester tests if an amplification is
positive. fixNA is used to impute missing values
from a data column. CPP can be used to normalize
curve data, to remove background, to remove outliers and further steps. Contains further functions to smooth the data by different
functions including LOWESS, Moving Average, Friedman's SuperSmoother, Cubic
Spline and Savitzky-Golay smoothing.
For more exhaustive description see the vignette (vignette("chipPCR")).
Stefan Roediger, Michal Burdukiewicz
Maintainer: Stefan Roediger <[email protected]>
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Nucleic acid detection based on the use of microbeads: a review. S. Roediger, C. Liebsch, C. Schmidt, W. Lehmann, U. Resch-Genger, U. Schedler, P. Schierack. Microchim Acta 2014:1–18. DOI: 10.1007/s00604-014-1243-4
Roediger S, Boehm A, Schimke I. Surface Melting Curve Analysis with R. The R Journal 2013;5:37–53.
Spiess, A.-N., Deutschmann, C., Burdukiewicz, M., Himmelreich, R., Klat, K., Schierack, P., Roediger, S., 2014. Impact of Smoothing on Parameter Estimation in Quantitative DNA Amplification Experiments. Clinical Chemistry clinchem.2014.230656. doi:10.1373/clinchem.2014.230656
# Example: A simple function to test for a background range. # Data were taken form the chipPCR C17 data set. data(C17) plot(C17[, 2], C17[, 3], xlab = "time [min]", ylab = "Fluorescence", pch = 20) res <- bg.max(C17[, 2], C17[, 3], bg.corr = 1.4, bg.start = 3) abline(v = c(slot(res, "bg.start"), slot(res, "bg.stop")), col = c(1,2)) abline(h = slot(res, "fluo"), col = "blue")# Example: A simple function to test for a background range. # Data were taken form the chipPCR C17 data set. data(C17) plot(C17[, 2], C17[, 3], xlab = "time [min]", ylab = "Fluorescence", pch = 20) res <- bg.max(C17[, 2], C17[, 3], bg.corr = 1.4, bg.start = 3) abline(v = c(slot(res, "bg.start"), slot(res, "bg.stop")), col = c(1,2)) abline(h = slot(res, "fluo"), col = "blue")
This function is a simple simulator of an amplification reaction based on a
5-parameter Richards function. This simplified approach was chosen because it
is impossible to model the shape of any amplification curve. An
implementation of realistic models is ambitious and not conclusively
addressed in the literature. First, they have to take “all” random
effects of noise into consideration and second, they need to be generic
enough to cover all amplification processes. More sophisticated mechanistic
models and simulations have been proposed elsewhere mehra_2005,
cobbs_2012. This approach of AmpSim is similar to the
pcrsim function from the qpcR package, which offers
simulations of sigmoidal qPCR data with goodness-of-fit analysis by
Ritz and Spiess 2008.
AmpSim(cyc = 1:35, b.eff = -25, bl = 0.05, ampl = 1, Cq = 20, noise = FALSE, nnl = 0.025, nnl.method = "constant")AmpSim(cyc = 1:35, b.eff = -25, bl = 0.05, ampl = 1, Cq = 20, noise = FALSE, nnl = 0.025, nnl.method = "constant")
cyc |
is a vector containing the cycle values. |
b.eff |
can be used to adjust the amplification efficiency. |
bl |
is used to define the base level (minimum) of the background range. |
ampl |
defines the plateau (maximum) of the amplification reaction. |
Cq |
defines approximately the quantification point (Cq) of the amplification reaction. |
noise |
adds some noise to the amplification reaction. |
nnl |
level of noise during the amplification reaction. |
nnl.method |
trend of noise level during the amplification reaction. "constant" uses same noise of amplification, "decreasing" leads to less noise at the end of the amplification reaction, and "increasing" leads to more noise at the end of the amplification reaction. |
AmpSim is a simple simulator for amplification reaction.
This function has several parameters which can be used to simulate the
amplification curve. b.eff and Cq are most connected with
another. Thus changing one of them will change both values. Cq can be
used to define an approximate Cq value. The expression "approximate Cq value" is
used here because the actual Cq value is dependent on the users preferred method
(e.g., Cy0 method, Second Derivative Maximum (SDM) method, threshold method).
AmpSim can be used to compare an experimental system to a
predicted model. Moreover it can be used to simulate data with noise, missing
values (NA), signal-to-noise ratios, photo-bleaching and other influences on a
PCR reaction.
Stefan Roediger, Michal Burdukiewicz
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Ritz, C., Spiess, A.-N.: qpcR: an R package for sigmoidal model selection in quantitative real-time polymerase chain reaction analysis. Bioinformatics 24(13), 1549–1551 (2008). doi:10.1093/bioinformatics/btn227. PMID: 18482995.
See also qpcR.news
# Example one # Simulate a qPCR reaction with AmpSim for 40 cycles. # Use an in-silico dilution of the template be adjusting # the Cq parameter. A change of 3.32 cycles corresponds # approximately to a 10-fold dilution. par(mfrow = c(2,1)) plot(NA, NA, xlim = c(1,40), ylim = c(0.01,2), xlab = "Cycles", ylab = "Fluorescence", main = "In-silco Dilution Experiment") cycle.dilution <- seq(18, 35, 3.32) for (i in 1:6) { lines(AmpSim(cyc = 1:40, b.eff = -25, bl = 0.01, ampl = 2, Cq = cycle.dilution[i]), type = "b", col = i, pch = 20) } # Example two # Simulate a qPCR reaction with AmpSim for 40 cycles and some noise. plot(NA, NA, xlim = c(1,40), ylim = c(0.01,2.2), xlab = "Cycles", ylab = "Fluorescence", main = "In-silco Dilution Experiment with Some Noise") cycle.dilution <- seq(18, 35, 3.32) for (i in 1:6) { lines(AmpSim(cyc = 1:40, b.eff = -25, bl = 0.01, ampl = 2, Cq = cycle.dilution[i], noise = TRUE, nnl = 0.05), type = "b", col = i, pch = 20) } par(mfrow = c(1,1)) # Example three # Apply constant, increasing, decreasing nose to # amplification data. par(mfrow = c(3,1)) method <- c("constant", "increase", "decrease") for (j in 1:3){ plot(NA, NA, xlim = c(1,40), ylim = c(0.02,2.2), xlab = "Cycles", ylab = "Fluorescence", main = paste("In-silco Dilution Experiment with noise method: ", method[j])) cycle.dilution <- seq(18, 35, 3.32) for (i in 1:6) { lines(AmpSim(cyc = 1:40, b.eff = -25, bl = 0.02, ampl = 2, Cq = cycle.dilution[i], noise = TRUE, nnl = 0.08, nnl.method = method[j]), type = "b", col = i, pch = 20) } } par(mfrow = c(1,1))# Example one # Simulate a qPCR reaction with AmpSim for 40 cycles. # Use an in-silico dilution of the template be adjusting # the Cq parameter. A change of 3.32 cycles corresponds # approximately to a 10-fold dilution. par(mfrow = c(2,1)) plot(NA, NA, xlim = c(1,40), ylim = c(0.01,2), xlab = "Cycles", ylab = "Fluorescence", main = "In-silco Dilution Experiment") cycle.dilution <- seq(18, 35, 3.32) for (i in 1:6) { lines(AmpSim(cyc = 1:40, b.eff = -25, bl = 0.01, ampl = 2, Cq = cycle.dilution[i]), type = "b", col = i, pch = 20) } # Example two # Simulate a qPCR reaction with AmpSim for 40 cycles and some noise. plot(NA, NA, xlim = c(1,40), ylim = c(0.01,2.2), xlab = "Cycles", ylab = "Fluorescence", main = "In-silco Dilution Experiment with Some Noise") cycle.dilution <- seq(18, 35, 3.32) for (i in 1:6) { lines(AmpSim(cyc = 1:40, b.eff = -25, bl = 0.01, ampl = 2, Cq = cycle.dilution[i], noise = TRUE, nnl = 0.05), type = "b", col = i, pch = 20) } par(mfrow = c(1,1)) # Example three # Apply constant, increasing, decreasing nose to # amplification data. par(mfrow = c(3,1)) method <- c("constant", "increase", "decrease") for (j in 1:3){ plot(NA, NA, xlim = c(1,40), ylim = c(0.02,2.2), xlab = "Cycles", ylab = "Fluorescence", main = paste("In-silco Dilution Experiment with noise method: ", method[j])) cycle.dilution <- seq(18, 35, 3.32) for (i in 1:6) { lines(AmpSim(cyc = 1:40, b.eff = -25, bl = 0.02, ampl = 2, Cq = cycle.dilution[i], noise = TRUE, nnl = 0.08, nnl.method = method[j]), type = "b", col = i, pch = 20) } } par(mfrow = c(1,1))
Launches graphical user interface that allows simulating and analyzing
amplification reactions. This function will open the GUI in a webpage
of the default browser. All parameters of the AmpSim
function can be used. In addition to this, the GUI shows some information calculated
by the bg.max in a summary field and a plot
below the simulated amplification curve.
AmpSim.gui()AmpSim.gui()
Any ad-blocking software may be cause of malfunctions.
Stefan Roediger, Michal Burdukiewicz.
# The code chunk below will fail if the web browser is not installed. if on UNIX platform try: # as.vector(Sys.getenv("R_BROWSER")) # Invoke the shiny AmpSim app in the default browser ## Not run: #do not execute using example(), it breaks the sequence of the plots in shiny app AmpSim.gui() ## End(Not run)# The code chunk below will fail if the web browser is not installed. if on UNIX platform try: # as.vector(Sys.getenv("R_BROWSER")) # Invoke the shiny AmpSim app in the default browser ## Not run: #do not execute using example(), it breaks the sequence of the plots in shiny app AmpSim.gui() ## End(Not run)
"amptest"
An S4 class containing the output amptester
function.
.Data:"numeric" is a vector containing the
fluorescence values.
decisions:"logical" contains outcomes of various tests.
shap.noisy is presence of noise, lrt.test states if data are
likely from a amplification curve and both tht.dec and tht.dec
defines if the amplification is "positive" or "negative".
noiselevel:"numeric" user-defined threshold for a
significant amplification signal.
background:range of the background signal in the amplification curve.
polygon:The pco test determines if the points in an amplification curve (like a polygon) are in a "clockwise" order. The sum over the edges result in a positive value if the amplification curve is "clockwise" and is negative if the curve is counter-clockwise.
slope.ratio:ratio of the slopes at the start and the end of exponential phase..
signature(object = "amptest"): prints summary
of the object. Silently returns vector of all calculated parameters.
signature(object = "amptest"): prints only
.Data slot of the object.
signature(object = "amptest"): plots input data and graphical
interpretation of link{amptester} tests' results.
Stefan Roediger, Michal Burdukiewicz
# Compare a positive and a negative amplification reaction. # First simulate positive reaction (fluo.pos) and than the # negative reaction (fluo.neg). # Simulation of an amplifiaction curve with some noise and a high signal. fluo.pos <- AmpSim(cyc = 1:40, noise = TRUE)[, 2] ampt.pos <- amptester(fluo.pos, manual = TRUE, background = c(0, 15), noiselevel = 0.15) # Plot amplification curve and result of amptester plot(fluo.pos, xlab = "Cycles", ylab = "RFU", pch = 19, ylim = c(0, 1)) lines(ampt.pos, col = 2, pch = 19, type = "b") legend(5, 1, c("Raw data", "amptester output"), col = c(1,2,3), bty = "n", pch = c(19, 19)) # Borders for background calculation abline(v = c(0,15), col = 2) # Level for background threshold abline(h = 0.15, col = 3, lty = 2) text(5, 0.18, "Noise threshold") # Summary of amptester results summary(ampt.pos) # Simulation of an amplifiaction curve with high noise and a low signal. fluo.neg <- AmpSim(cyc = 1:40, noise = TRUE, ampl = 0.13, nnl = 0.4)[, 2] ampt.neg <- amptester(fluo.neg, manual = TRUE, background = c(0, 15), noiselevel = 0.15) # Plot amplification curve and result of amptester plot(fluo.neg, xlab = "Cycles", ylab = "RFU", pch = 19, ylim = c(0, 1)) lines(ampt.neg, col = 2, pch = 19, type = "b") legend(5, 1, c("Raw data", "amptester output"), col = c(1,2,3), bty = "n", pch = c(19, 19)) # Borders for background calculation abline(v = c(0,15), col = 2) # Level for background threshold abline(h = 0.15, col = 3, lty = 2) text(5, 0.18, "Noise threshold") # Summary of amptester results summary(ampt.neg) #plot amptester results plot(ampt.neg)# Compare a positive and a negative amplification reaction. # First simulate positive reaction (fluo.pos) and than the # negative reaction (fluo.neg). # Simulation of an amplifiaction curve with some noise and a high signal. fluo.pos <- AmpSim(cyc = 1:40, noise = TRUE)[, 2] ampt.pos <- amptester(fluo.pos, manual = TRUE, background = c(0, 15), noiselevel = 0.15) # Plot amplification curve and result of amptester plot(fluo.pos, xlab = "Cycles", ylab = "RFU", pch = 19, ylim = c(0, 1)) lines(ampt.pos, col = 2, pch = 19, type = "b") legend(5, 1, c("Raw data", "amptester output"), col = c(1,2,3), bty = "n", pch = c(19, 19)) # Borders for background calculation abline(v = c(0,15), col = 2) # Level for background threshold abline(h = 0.15, col = 3, lty = 2) text(5, 0.18, "Noise threshold") # Summary of amptester results summary(ampt.pos) # Simulation of an amplifiaction curve with high noise and a low signal. fluo.neg <- AmpSim(cyc = 1:40, noise = TRUE, ampl = 0.13, nnl = 0.4)[, 2] ampt.neg <- amptester(fluo.neg, manual = TRUE, background = c(0, 15), noiselevel = 0.15) # Plot amplification curve and result of amptester plot(fluo.neg, xlab = "Cycles", ylab = "RFU", pch = 19, ylim = c(0, 1)) lines(ampt.neg, col = 2, pch = 19, type = "b") legend(5, 1, c("Raw data", "amptester output"), col = c(1,2,3), bty = "n", pch = c(19, 19)) # Borders for background calculation abline(v = c(0,15), col = 2) # Level for background threshold abline(h = 0.15, col = 3, lty = 2) text(5, 0.18, "Noise threshold") # Summary of amptester results summary(ampt.neg) #plot amptester results plot(ampt.neg)
The amptester function tests if an amplification is significant.
amptester(y, manual = FALSE, noiselevel = 0.08, background = NULL)amptester(y, manual = FALSE, noiselevel = 0.08, background = NULL)
y |
is a vector containing the fluorescence values. |
manual |
switches between a statistical test (based on a Wilcoxon rank sum
test ( |
noiselevel |
can be set to a user defined value as threshold for a significant amplification signal. |
background |
is the range of the background signal in the amplification curve.
The values can be added by the user or taken from the
|
This function tries to estimate if data indicates an amplification process.
Several instances of tests are included. The first involves a
semiautomatic test if the range of the background is lower than the range
of the assumed signal. To differ between the ranges an instance of
bg.max is used. Herein, this function assumes that an
amplification takes place in case the signal of the amplification is larger
than the median + 5 * mad than
the background. The automatic test uses a Wilcoxon rank sum test
wilcox.test to compare the first and the last elements
of the data. The input values are delivered by head
and tail, respectively. For other methods please refer
to the references listed below. Instead of assigning a zero to negative
amplification reaction uses the current implementation of
amptester very small random values. This is because
some post function might fail in case all values are set to zero.
# FIRST TEST - Shapiro test (SHt)
This is a simple test based on the hypothesis that in case amplification curve data come from noise is the distribution similar to a normal distribution. The Shapiro's normality test is used to test this hypothesis. If p is >= 5e-04, then the distribution of the curve data indicates noise (no amplification).
# SECOND TEST - Resids growth test (RGt)
This tests if fluorescence values in a linear phase are stable. Whenever no amplification occurs, fluorescence values quickly deviate from linear model. Their standardized residuals will be strongly correlated with their value. For real amplification curves, situation is much more stable. Noise (that means deviations from linear model) in background do not correlate strongly with the changes in fluorescence. The decision is based on the threshold value (here 0.5).
# THIRD TEST - Linear Regression test (LRt)
This test determines the R^2 by a linear regression. The R^2 are determined from a run of circa 15 percent range of the data. If a sequence of more than six R^2s is larger than 0.8 is found that is likely a nonlinear signal. This is a bit counterintuitive because R^2 of nonlinear data should be low.
# FOURTH TEST (MANUAL) - Threshold test (THt)
This a commonly employed method. In the manual test one needs to define a fixed threshold. If the amplification curve signal exceeds the threshold than the amplification reaction is positive. Waring: This method will report positive amplification reaction if a negative amplification has a positive trend.
# FOURTH TEST (AUTOMATIC) - Threshold test (THt)
Takes the first 20 percent and the last 15 percent of any input data set (amplification curve) and perform a Wilcoxon rank sum tests with the head (nh) and tail (nt). This test is recommended over the manual THt. Warning: This method may report positive amplification reaction if a negative amplification has a positive trend.
# FIFTH TEST - Signal level test (SLt)
The meaningfulness of an amplification curve reaction can be tested by comparison of the signals 1) A robust "sigma" rule by median + 2 * mad 2) comparison of the signal/noise ratio. If less than 1.25 (25 percent) signal increase it is likely that nothing happened during the reaction. Waring: This method may report positive amplification reaction if a negative amplification has a positive trend.
# SIXTH TEST - pco test (pco)
This test determines if the points in an amplification curve (like a polygon, in particular non-convex polygons) are in a "clockwise" order. The sum over the edges result in a positive value if the amplification curve is "clockwise" and is negative if the curve is counter-clockwise ((x2 - x1)(y2 + y1)). From experience is noise positive and "true" amplification curves "highly" negative. This test depends on the definition of a threshold.
# SEVENTH TEST - Slope ratio (SlR)
Uses the inder function to find the approximated first derivative maximum, second derivative minimum and the second derivative maximum. Next the raw fluorescence at the approximated second derivative minimum and the second derivative maximum are taken from the original data set. The fluorescence intensities are normalized to the maximum fluorescence of this data. This data is used for a linear regression. Where the slope is used.
An object of amptest class containing result of the test as well as
the original data.
Stefan Roediger, Michal Burdukiewicz
Frank, D. N. BARCRAWL and BARTAB: software tools for the design and implementation of barcoded primers for highly multiplexed DNA sequencing BMC bioinformatics, 2009, Vol. 10, pp. 362
Peirson, S. N., Butler, J. N. and Foster, R. G. Experimental validation of novel and conventional approaches to quantitative real-time PCR data analysis Nucleic Acids Research, 2003, Vol. 31(14), pp. e73-e73
Rao, X., Lai, D. and Huang, X. A New Method for Quantitative Real-Time Polymerase Chain Reaction Data Analysis Journal of Computational Biology, 2013, Vol. 20(9), pp. 703-711
Ruijter, J. M., Ramakers, C., Hoogaars, W. M. H., Karlen, Y., Bakker, O., Hoff, M. J. B. v. d. and Moorman, A. F. M. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data, Nucleic Acids Research, 2009, Vol. 37(6), pp. e45-e45
Rutledge, R. G. and Stewart, D. A kinetic-based sigmoidal model for the polymerase chain reaction and its application to high-capacity absolute quantitative real-time PCR BMC biotechnology, 2008, Vol. 8, pp. 47
Tichopad, A., Dilger, M., Schwarz, G. and Pfaffl, M. W. Standardized determination of real-time PCR efficiency from a single reaction set-up Nucleic Acids Research, 2003, Vol. 31(20), pp. e122
Wilhelm, J., Pingoud, A. and Hahn, M. SoFAR: software for fully automatic evaluation of real-time PCR data BioTechniques, 2003, Vol. 34(2), pp. 324-332
Zhao, S. and Fernald, R. D. Comprehensive Algorithm for Quantitative Real-Time Polymerase Chain Reaction Journal of computational biology: a journal of computational molecular cell biology, 2005, Vol. 12(8), pp. 1047-1064
# First example # Arrange graphs in orthogonal matrix and set parameter for the plot. par(las = 0, bty = "n", cex.axis = 1.5, cex.lab = 1.5, font = 2, cex.main = 1.8, oma = c(1,1,1,1)) # Simulation of an amplification curve with 40 cycles and a Cq of # circa 28. The amplification curve of "pos" (positive) has low # noise and the amplification curve of "neg" (negative) has high # noise. pos <- AmpSim(cyc = 1:40, Cq = 28, noise = TRUE, nnl = 0.03) neg <- AmpSim(cyc = 1:40, Cq = 28, noise = TRUE, nnl = 0.8) # Plot the raw data of the simulations. par(fig = c(0,0.5,0.5,1)) plot(NA, NA, xlim = c(1, 40), ylim = c(0, 2.1), xlab = "Cycles", ylab = "Fluorescence", main = "qPCR - Raw data", type = "b") mtext("A", cex = 2, side = 3, adj = 0, font = 2) points(pos, col = 1, typ = "b", pch = 19) points(neg, col = 2, typ = "b", pch = 20) legend(1, 2, c("Positive", "Negative Control (noise)"), pch = c(19,20), col = c(1,2), lwd = 2, bty = "n") # Plot data again after an analysis by ampteser. "neg" is set to small # random numbers, while "pos" remains unchanged. par(fig = c(0,0.5,0,0.5), new = TRUE) plot(NA, NA, xlim = c(1, 40), ylim = c(0, 2.1), xlab = "Cycles", ylab = "Fluorescence", main = "qPCR - amptester", type = "b") points(amptester(pos[, 2]), col = 1, type = "b", pch = 19) points(amptester(neg[, 2]), col = 2, type = "b", pch = 20) legend(1, 2, c("Positive", "Negative Control (noise)"), pch = c(19,20), col = c(1,2), lwd = 2, bty = "n") # Use of amptester for time-dependent measurements. Amplification curves # from the capillaryPCR data set were processed in a loop. The results of # amptester are added to the raw data. par(fig = c(0.5,1,0,1), new = TRUE) colors <- rainbow(8) plot(NA, NA, xlim = c(0,80), ylim = c(0,1300), xlab = "Time [min]", ylab = "Voltage (micro V)", main = "ccPCR") mtext("B", cex = 2, side = 3, adj = 0, font = 2) sapply(c(1,3,5,7), function(i) { xy.tmp <- cbind(capillaryPCR[1:750, i], capillaryPCR[1:750, i + 1]) # Use amptester to analyse the amplification curve. # Note: The decisions of amptester can be invoked via res.ampt@decisions # in the present example. res.ampt <- amptester(xy.tmp[, 2]) # Use the "decisions" of amptester in a logic to automatically decide if an # amplification reaction is positive. In this example linear regression test # (lrt.test) and the threshold test (tht.dec) are used. res.ampt <- ifelse(res.ampt@decisions[2] == TRUE && res.ampt@decisions[4] == TRUE, "positve", "negative") # Plot the amplification curve with the decisions. lines(xy.tmp[, 1], xy.tmp[, 2], type = "b", pch = 20, col = colors[i]) text(75, max(na.omit(xy.tmp[, 2])), res.ampt, cex = 1.3, col = colors[i]) } ) # Second Example # Example to test an amplification reaction. # Simulate first a positive amplification curve with 45 cycles and than a # negative amplification curve with 45 cycles. The negative amplification # curve is created from a normal distribution # fluo.neg <- rnorm(45) fluo.pos <- AmpSim(cyc = 1:45, Cq = 45, ampl = 40, noise = TRUE, nnl = 0.03)[, 2] plot(NA, NA, xlim = c(1, 45), ylim = c(-1, 45), xlab = "Cycles", ylab = "Fluorescence", main = "Simulation of a qPCR with 45 Cycles", type = "b") points(amptester(fluo.pos), type = "b", pch = 20) points(amptester(fluo.neg), type = "b", col = "red", pch = 20) points(1:45, fluo.neg, col = "red") legend(1,40, c("Positive", "Negative Control (noise)", "noise pattern"), pch = c(20,20,1), col = c(1,2,2), lwd = 2)# First example # Arrange graphs in orthogonal matrix and set parameter for the plot. par(las = 0, bty = "n", cex.axis = 1.5, cex.lab = 1.5, font = 2, cex.main = 1.8, oma = c(1,1,1,1)) # Simulation of an amplification curve with 40 cycles and a Cq of # circa 28. The amplification curve of "pos" (positive) has low # noise and the amplification curve of "neg" (negative) has high # noise. pos <- AmpSim(cyc = 1:40, Cq = 28, noise = TRUE, nnl = 0.03) neg <- AmpSim(cyc = 1:40, Cq = 28, noise = TRUE, nnl = 0.8) # Plot the raw data of the simulations. par(fig = c(0,0.5,0.5,1)) plot(NA, NA, xlim = c(1, 40), ylim = c(0, 2.1), xlab = "Cycles", ylab = "Fluorescence", main = "qPCR - Raw data", type = "b") mtext("A", cex = 2, side = 3, adj = 0, font = 2) points(pos, col = 1, typ = "b", pch = 19) points(neg, col = 2, typ = "b", pch = 20) legend(1, 2, c("Positive", "Negative Control (noise)"), pch = c(19,20), col = c(1,2), lwd = 2, bty = "n") # Plot data again after an analysis by ampteser. "neg" is set to small # random numbers, while "pos" remains unchanged. par(fig = c(0,0.5,0,0.5), new = TRUE) plot(NA, NA, xlim = c(1, 40), ylim = c(0, 2.1), xlab = "Cycles", ylab = "Fluorescence", main = "qPCR - amptester", type = "b") points(amptester(pos[, 2]), col = 1, type = "b", pch = 19) points(amptester(neg[, 2]), col = 2, type = "b", pch = 20) legend(1, 2, c("Positive", "Negative Control (noise)"), pch = c(19,20), col = c(1,2), lwd = 2, bty = "n") # Use of amptester for time-dependent measurements. Amplification curves # from the capillaryPCR data set were processed in a loop. The results of # amptester are added to the raw data. par(fig = c(0.5,1,0,1), new = TRUE) colors <- rainbow(8) plot(NA, NA, xlim = c(0,80), ylim = c(0,1300), xlab = "Time [min]", ylab = "Voltage (micro V)", main = "ccPCR") mtext("B", cex = 2, side = 3, adj = 0, font = 2) sapply(c(1,3,5,7), function(i) { xy.tmp <- cbind(capillaryPCR[1:750, i], capillaryPCR[1:750, i + 1]) # Use amptester to analyse the amplification curve. # Note: The decisions of amptester can be invoked via res.ampt@decisions # in the present example. res.ampt <- amptester(xy.tmp[, 2]) # Use the "decisions" of amptester in a logic to automatically decide if an # amplification reaction is positive. In this example linear regression test # (lrt.test) and the threshold test (tht.dec) are used. res.ampt <- ifelse(res.ampt@decisions[2] == TRUE && res.ampt@decisions[4] == TRUE, "positve", "negative") # Plot the amplification curve with the decisions. lines(xy.tmp[, 1], xy.tmp[, 2], type = "b", pch = 20, col = colors[i]) text(75, max(na.omit(xy.tmp[, 2])), res.ampt, cex = 1.3, col = colors[i]) } ) # Second Example # Example to test an amplification reaction. # Simulate first a positive amplification curve with 45 cycles and than a # negative amplification curve with 45 cycles. The negative amplification # curve is created from a normal distribution # fluo.neg <- rnorm(45) fluo.pos <- AmpSim(cyc = 1:45, Cq = 45, ampl = 40, noise = TRUE, nnl = 0.03)[, 2] plot(NA, NA, xlim = c(1, 45), ylim = c(-1, 45), xlab = "Cycles", ylab = "Fluorescence", main = "Simulation of a qPCR with 45 Cycles", type = "b") points(amptester(fluo.pos), type = "b", pch = 20) points(amptester(fluo.neg), type = "b", col = "red", pch = 20) points(1:45, fluo.neg, col = "red") legend(1,40, c("Positive", "Negative Control (noise)", "noise pattern"), pch = c(20,20,1), col = c(1,2,2), lwd = 2)
amptester.gui is a graphical user interface for the
amptester function. This function can be used for a
fast and convenient analysis of amplification curve data. In addition it is
possible to analyze the Cq (quantification cycle) and to perform a report
generation of the analyzed data.
amptester.gui()amptester.gui()
Any ad-blocking software may be cause of malfunctions.
Stefan Roediger, Michal Burdukiewicz.
# The code chunk below will fail if the web browser is not installed. if on UNIX platform try: # as.vector(Sys.getenv("R_BROWSER")) # Invoke the shiny AmpSim app in the default browser ## Not run: #do not execute using example(), it breaks the sequence of the plots in shiny app amptester.gui() ## End(Not run)# The code chunk below will fail if the web browser is not installed. if on UNIX platform try: # as.vector(Sys.getenv("R_BROWSER")) # Invoke the shiny AmpSim app in the default browser ## Not run: #do not execute using example(), it breaks the sequence of the plots in shiny app amptester.gui() ## End(Not run)
"bg"
An S4 class containing the output bg.max function.
.Data:"matrix" which columns represent respectively cycle number,
raw fluorescence data, first derivative and second derivative.
bg.start:"numeric" value representing start of the background range.
bg.stop:"numeric" value representing end of the background range.
bg.corr:"numeric" a value which helps to tweak on the suggested
background value of bg.max.
fluo:"numeric" a value of fluorescence at the end of amplification.
amp.stop:"numeric" value representing end of the amplification
.
signature(x = "bg"): plots background information.
See plot.bg
signature(object = "bg"): prints only .Data slot of the
object.
signature(object = "bg"): prints information about object
prettier than show and allows easy access to some slots. See
summary.bg
Stefan Roediger, Michal Burdukiewicz
res <- AmpSim(cyc = 1:40, Cq = 25) tmp <- bg.max(res) summary(tmp) plot(tmp)res <- AmpSim(cyc = 1:40, Cq = 25) tmp <- bg.max(res) summary(tmp) plot(tmp)
bg.max detects and corrects background noise.
The detection is made without any assumptions
regarding the model of this function.
## S4 method for signature 'numeric,numeric' bg.max(x, y, bg.corr = 1.3, bg.start = 2, inder.approx = TRUE) ## S4 method for signature 'matrix,missing' bg.max(x, y, bg.corr = 1.3, bg.start = 2, inder.approx = TRUE) ## S4 method for signature 'data.frame,missing' bg.max(x, y, bg.corr = 1.3, bg.start = 2, inder.approx = TRUE)## S4 method for signature 'numeric,numeric' bg.max(x, y, bg.corr = 1.3, bg.start = 2, inder.approx = TRUE) ## S4 method for signature 'matrix,missing' bg.max(x, y, bg.corr = 1.3, bg.start = 2, inder.approx = TRUE) ## S4 method for signature 'data.frame,missing' bg.max(x, y, bg.corr = 1.3, bg.start = 2, inder.approx = TRUE)
x |
is a vector containing the time or cycle values or data frame/matrix containing cycle in the first column and fluorescence values in the second column. |
y |
is a vector containing the fluorescence values. Used only if |
bg.corr |
a value which helps to tweak on the suggested background value of
|
bg.start |
a user defined value for the start of the background range. |
inder.approx |
a |
Background range herein refers to a level of fluorescence measured before
any specific amplification is detectable. The raw data (e.g., fluorescence
intensity) measured after each step (cycle or time point) follow a
non-linear progress. The background is assumed to be constant for the
entire measurement. The algorithm of bg.max is based
on the assumption that during the linear ground phase the signal difference
of successive cycles is approximately constant. After transition to the
early exponential phase the signal changes drastically. First data are
smoothed by Friedman's 'super smoother' (as found in
supsmu. Thereof the approximate first and second
derivative are calculated by a five-point stencil
inder.
The difference of cycles at the maxima of the first and second approximate
derivative as well as a correction factor are used to estimate the range before
the exponential phase. This function finds the background range
without modeling the relationship between signal and cycle number. The start of
the background range is defined be a fixed value. Since many signals tend to
overshot in the first cycles a default value of 3 is chosen.
bg.max tries also to estimate the end of an amplification
reaction.
An object of bg class containing predicted background range as well
as other parameters.
Stefan Roediger, Michal Burdukiewicz
D. N. Frank. BARCRAWL and BARTAB: software tools for the design and implementation of barcoded primers for highly multiplexed DNA sequencing. BMC Bioinformatics, 10:362, 2009. ISSN 1471-2105. doi: 10.1186/1471-2105-10-362. PMID: 19874596 PMCID: PMC2777893.
S. N. Peirson, J. N. Butler, and R. G. Foster. Experimental validation of novel and conventional approaches to quantitative real-time PCR data analysis. Nucleic Acids Research, 31(14):e73, July 2003. ISSN 1362-4962. PMID: 12853650 PMCID: PMC167648.
X. Rao, D. Lai, and X. Huang. A new method for quantitative real-time polymerase chain reaction data analysis. Journal of computational biology: a journal of computational molecular cell biology, 20(9):703–711, Sept. 2013. ISSN 1557-8666. doi: 10.1089/cmb.2012.0279. PMID: 23841653 PMCID: PMC3762066.
A. Tichopad, M. Dilger, G. Schwarz, and M. W. Pfaffl. Standardized determination of real-time PCR efficiency from a single reaction set-up. Nucleic Acids Research, 31(20):e122, Oct. 2003. ISSN 1362-4962. PMID: 14530455 PMCID: PMC219490.
J. Wilhelm, A. Pingoud, and M. Hahn. Real-time PCR-based method for the estimation of genome sizes. Nucleic Acids Research, 31(10):e56, May 2003. ISSN 0305-1048. PMID: 12736322 PMCID: PMC156059.
S. Zhao and R. D. Fernald. Comprehensive algorithm for quantitative real-time polymerase chain reaction. Journal of computational biology: a journal of computational molecular cell biology, 12(8): 1047–1064, Oct. 2005. ISSN 1066-5277. doi:10.1089/cmb.2005.12.1047. PMID: 16241897 PMCID: PMC2716216.
# First example: Test for the background of an amplification reaction. par(mfrow = c(2,1)) res <- AmpSim(cyc = 1:40, Cq = 25) background <- bg.max(res) plot(background, main = "Estimation of the Background Range\n in Absence of Noise") res.noise <- AmpSim(cyc = 1:40, Cq = 25, noise = TRUE) background.noise <- bg.max(res.noise) plot(background.noise, main = "Estimation of the Background Range\n in Presence of Noise") par(mfrow = c(1,1)) # Second example: A simple function to test for a background range. # Data were taken form the chipPCR C17 data set. # Note that the not the time but the "cycle number" was # used to calculate the background range. data(C17) plot(C17[, 2], C17[, 3], xlab = "Cycle", ylab = "RFU", main = "Estimate the begin of the Amplification\n of a HDA", pch = 20) res <- bg.max(C17[, 2:3], bg.corr = 1.4, bg.start = 1) abline(v = c(slot(res, "bg.start"), slot(res, "bg.stop")), col = c(1,2)) abline(h = slot(res, "fluo"), col = "blue") # Third example: Test for the background of an amplification reaction. # Simulate amplification curves with different quantification points # within 40 cycles. cyc <- seq(1, 40, 1) # Use a five parameter model to simulate amplification curves b <- -15; c <- 0.02; d <- 1 # Define the different quantification points with a difference of # circa 3.32 cycles e <- seq(21, 35, 3.32) # Plot the amplification curves and the estimated background ranges. plot(NA, NA, xlim = c(1, 40), ylim = c(0, 1), xlab = "Cycles", ylab = "Fluorescence") for (i in 1:length(e)) { fluo <- c + (d - c)/(1 + exp(b * (log(cyc) - log(e[i])))) points(cyc, fluo, type = "b", col = i, pch = 20) res <- bg.max(cyc, fluo, bg.corr = 1.4, bg.start = 1) abline(v = slot(res, "bg.stop"), col = i) abline(h = slot(res, "fluo"), col = i) }# First example: Test for the background of an amplification reaction. par(mfrow = c(2,1)) res <- AmpSim(cyc = 1:40, Cq = 25) background <- bg.max(res) plot(background, main = "Estimation of the Background Range\n in Absence of Noise") res.noise <- AmpSim(cyc = 1:40, Cq = 25, noise = TRUE) background.noise <- bg.max(res.noise) plot(background.noise, main = "Estimation of the Background Range\n in Presence of Noise") par(mfrow = c(1,1)) # Second example: A simple function to test for a background range. # Data were taken form the chipPCR C17 data set. # Note that the not the time but the "cycle number" was # used to calculate the background range. data(C17) plot(C17[, 2], C17[, 3], xlab = "Cycle", ylab = "RFU", main = "Estimate the begin of the Amplification\n of a HDA", pch = 20) res <- bg.max(C17[, 2:3], bg.corr = 1.4, bg.start = 1) abline(v = c(slot(res, "bg.start"), slot(res, "bg.stop")), col = c(1,2)) abline(h = slot(res, "fluo"), col = "blue") # Third example: Test for the background of an amplification reaction. # Simulate amplification curves with different quantification points # within 40 cycles. cyc <- seq(1, 40, 1) # Use a five parameter model to simulate amplification curves b <- -15; c <- 0.02; d <- 1 # Define the different quantification points with a difference of # circa 3.32 cycles e <- seq(21, 35, 3.32) # Plot the amplification curves and the estimated background ranges. plot(NA, NA, xlim = c(1, 40), ylim = c(0, 1), xlab = "Cycles", ylab = "Fluorescence") for (i in 1:length(e)) { fluo <- c + (d - c)/(1 + exp(b * (log(cyc) - log(e[i])))) points(cyc, fluo, type = "b", col = i, pch = 20) res <- bg.max(cyc, fluo, bg.corr = 1.4, bg.start = 1) abline(v = slot(res, "bg.stop"), col = i) abline(h = slot(res, "fluo"), col = i) }
A quantitative PCR (qPCR) with the DNA binding dye (EvaGreen) (Mao et al. 2007) was performed in a Bio-Rad iQ5 thermo cycler. The cycle-dependent increase of the fluorescence was quantified at the annealing step (59.5 degrees Celsius).
data(C126EG595)data(C126EG595)
A data frame with 40 observations on the following 97 variables. The first column ("Cycle") contains the number of cycles and consecutive columns contain the replicates ("A01" to "H12").
HPRT1 was amplified in the Bio-Rad iQ5. The the change of fluorescence was simultaneously monitored for the Hydrolysis probe of HPRT1 and EvaGreen. The primer sequences for HPRT1 were taken from Roediger et al. (2013). A 10 micro L qPCR reaction was composed of 250 nM primer (forward and reverse), qPCR Mix (according to the manufactures recommendations), 1 micro L template (HPRT1 amplification product), 60 nM hydrolysis probe probe for HPRT1. EvaGreen was used at 0.5 x final. During the amplification was monitored 59.5 degrees Celsius.
Stefan Roediger, Claudia Deutschmann (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Mao, F., Leung, W.-Y., Xin, X., 2007. Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7, 76.
data(C126EG595) tmp <- C126EG595 plot(NA,NA, xlim = c(1,40), ylim = c(min(tmp[, 2:ncol(tmp)]), max(tmp[, 2:ncol(tmp)])), xlab = "Cycle", ylab = "RFU (FAM)", main = "Amplification monitored at \n58.5 degrees Celsius (annealing step)") apply(tmp[, 2:ncol(tmp)], 2, function(x) lines(tmp[1:nrow(tmp),1],x))data(C126EG595) tmp <- C126EG595 plot(NA,NA, xlim = c(1,40), ylim = c(min(tmp[, 2:ncol(tmp)]), max(tmp[, 2:ncol(tmp)])), xlab = "Cycle", ylab = "RFU (FAM)", main = "Amplification monitored at \n58.5 degrees Celsius (annealing step)") apply(tmp[, 2:ncol(tmp)], 2, function(x) lines(tmp[1:nrow(tmp),1],x))
A quantitative PCR (qPCR) with the DNA binding dye (EvaGreen) (Mao et al. 2007) was performed in the Roche Light Cycler 1.5 thermo cycler. The cycle-dependent increase of the fluorescence was quantified at the elongation step (68.5 degrees Celsius).
data(C126EG685)data(C126EG685)
A data frame with 40 observations on the following 97 variables. The first column ("Cycles") contains the number of cycles and consecutive columns contain the replicates ("A01" to "H12").
MLC-2v was amplified in the Roche Light Cycler 1.5. The the change of fluorescence was simultaneously monitored for the Hydrolysis probe of MLC-2v and EvaGreen. The primer sequences for MLC-2v were taken from Roediger et al. (2013). A 10 micro L qPCR reaction was composed of 250 nM primer (forward and reverse), qPCR Mix (according to the manufactures recommendations), 1 micro L template (MLC-2v amplification product), 60 nM hydrolysis probe probe for MLC-2v. EvaGreen was used at 0.5 x final. The amplification was monitored at 68.5 degrees Celsius (elongation step).
Claudia Deutschmann & Stefan Roediger, BTU Cottbus - Senftenberg, Senftenberg, Germany
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Mao, F., Leung, W.-Y., Xin, X., 2007. Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7, 76.
data(C126EG685) tmp <- C126EG685 plot(NA,NA, xlim = c(1,40), ylim = c(min(tmp[, 2:ncol(tmp)]), max(tmp[, 2:ncol(tmp)])), xlab = "Cycle", ylab = "RFU (FAM)", main = "Amplification monitored at \n68.5 degrees Celsius (elongation step)") apply(tmp[, 2:ncol(tmp)], 2, function(x) lines(tmp[1:nrow(tmp),1],x))data(C126EG685) tmp <- C126EG685 plot(NA,NA, xlim = c(1,40), ylim = c(min(tmp[, 2:ncol(tmp)]), max(tmp[, 2:ncol(tmp)])), xlab = "Cycle", ylab = "RFU (FAM)", main = "Amplification monitored at \n68.5 degrees Celsius (elongation step)") apply(tmp[, 2:ncol(tmp)], 2, function(x) lines(tmp[1:nrow(tmp),1],x))
Quantitative PCR (qPCR) with a hydrolysis probe (Cy5/BHQ2) and DNA binding dye (EvaGreen) (Mao et al. 2007) was performed in the Roche Light Cycler 1.5 thermo cycler. The cycle-dependent increase of the fluorescence was quantified at the annealing step.
data(C127EGHP)data(C127EGHP)
A data frame with 40 observations on the following 66 variables. The first columns ("index") contains index of a sample and second column ("Cycle") contains the number of cycle. Consecutive columns EG1-EG32 contains fluorescence data for Eva Green dye. Consecutive columns HP1-HP32 contains data for hydrolysis probe.
MLC-2v was amplified in the Roche Light Cycler 1.5. The the change of fluorescence was simultaneously monitored for the Hydrolysis probe of MLC-2v and EvaGreen. The primer sequences for MLC-2v were taken from Roediger et al. (2013). A 10 micro L qPCR reaction was composed of 250 nM primer (forward and reverse), qPCR Mix (according to the manufactures recommendations), 1 micro L template (MLC-2v amplification product), 60 nM hydrolysis probe probe for MLC-2v. EvaGreen was used at 0.5 x final. During the amplification was monitored 59.5 degrees Celsius.
Claudia Deutschmann & Stefan Roediger, BTU Cottbus - Senftenberg, Senftenberg, Germany
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Mao, F., Leung, W.-Y., Xin, X., 2007. Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7, 76.
str(C127EGHP) data(C127EGHP) tmp <- C127EGHP par(mfrow = c(2,1)) plot(NA, NA, xlim = c(1,40), ylim = c(0,10), xlab = "Cycle", ylab = "Fluorescence", main = "MLC-2v qPCR - EvaGreen") for (i in 3:34) { points(tmp[, 2], tmp[, i], type = "l", col = i) } plot(NA, NA, xlim = c(1,40), ylim = c(0,10), xlab = "Cycle", ylab = "Fluorescence", main = "MLC-2v qPCR - Hydrolysis probe") for (i in 35:66) { points(tmp[, 2], tmp[, i], type = "l", col = i) } par(mfrow = c(1,1))str(C127EGHP) data(C127EGHP) tmp <- C127EGHP par(mfrow = c(2,1)) plot(NA, NA, xlim = c(1,40), ylim = c(0,10), xlab = "Cycle", ylab = "Fluorescence", main = "MLC-2v qPCR - EvaGreen") for (i in 3:34) { points(tmp[, 2], tmp[, i], type = "l", col = i) } plot(NA, NA, xlim = c(1,40), ylim = c(0,10), xlab = "Cycle", ylab = "Fluorescence", main = "MLC-2v qPCR - Hydrolysis probe") for (i in 35:66) { points(tmp[, 2], tmp[, i], type = "l", col = i) } par(mfrow = c(1,1))
A Helicase Dependent Amplification (HDA) of HPRT1 (Homo sapiens hypoxanthine phosphoribosyltransferase 1) was performed at different temperatures in the 'VideoScan' Platform 2.0 (similar to Roediger et al. (2013)). The HDA was performed at 55, 60 and 65 degrees Celsius. The optimal temperature for a HDA is circa 65 degrees Celsius. Lower temperatures will affect the slope and plateau of the HDA amplification curve.
data(C17)data(C17)
A data frame with 125 observations on the following 5 variables.
C17.tElapsed time during HDA in seconds.
C17.cyclea numeric vector
C17.T55Time-dependent fluorescence at 55 degrees Celsius
C17.T60Time-dependent fluorescence at 60 degrees Celsius
C17.T65Time-dependent fluorescence at 65 degrees Celsius
To perform an isothermal amplification in 'VideoScan' 2.0, standard conditions for the IsoAmp(R) III Universal tHDA Kit (Biohelix) were used. The reaction was composed of 12.5 micro L buffer A containing 1.25 micro L 10x reaction buffer, 150 nM primer (forward and reverse), 0.75 micro L template (synthetic) and A. bidest which was covered with 50 micro L mineral oil. The primer sequences for HPRT1 were taken from Roediger et al. (2013). Preincubation: This mixture was incubated for 2 min at 95 degree. Celsius and immediately placed on ice. 12.5 micro L of reaction buffer B which was composed of 1.25 micro L 10x buffer, 40 mM NaCl, 5 mM MgSO4, 1.75 micro L dNTPs, 0.2 x EvaGreen, 1 micro L Enzyme mix and A. bidest. The fluorescence measurement in 'VideoScan' 'HCU' started directly after adding buffer B at 55, 60 or 65 degrees Celsius and revealed optimal conditions for the amplification when using 60 or 65 degrees Celsius. Temperature profile (after Preincubation): - 60 seconds at 65 degrees Celsius - 11 seconds at 55 degrees Celsius && Measurement
Claudia Deutschmann & Stefan Roediger, BTU Cottbus - Senftenberg, Senftenberg, Germany
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
data(C17) plot(NA, NA, xlim = c(0,5000), ylim = c(0,1.2), xlab = "Time [sec]", ylab = "Fluorescence", main = "Temperature dependency of HDA amplification reactions") points(C17[, 1], C17[, 3], type = "b", col = 1, pch = 20) points(C17[, 1], C17[, 4], type = "b", col = 2, pch = 20) points(C17[, 1], C17[, 5], type = "b", col = 3, pch = 20) legend(2000, 0.4, c("55 degrees Celsius", "60 degrees Celsius", "65 degrees Celsius"), col = c(1,2,3), pch = rep(20,3))data(C17) plot(NA, NA, xlim = c(0,5000), ylim = c(0,1.2), xlab = "Time [sec]", ylab = "Fluorescence", main = "Temperature dependency of HDA amplification reactions") points(C17[, 1], C17[, 3], type = "b", col = 1, pch = 20) points(C17[, 1], C17[, 4], type = "b", col = 2, pch = 20) points(C17[, 1], C17[, 5], type = "b", col = 3, pch = 20) legend(2000, 0.4, c("55 degrees Celsius", "60 degrees Celsius", "65 degrees Celsius"), col = c(1,2,3), pch = rep(20,3))
A quantitative real-time PCR of adk was performed.
data("C316.amp")data("C316.amp")
A data frame with 40 observations on the following 97 variables. The first column ("Cycle") contains the number of cycles and consecutive columns contain the replicates ("A01" to "H12").
adk was amplified in the Bio-Rad iQ5. The change of fluorescence was simultaneously monitored (EvaGreen, Mao et al. 2007). The primer sequences for adk were taken from this study.
gDNA: 28.43 ng/microL DNA concentration, 260/280 ratio= 1.96
adk fw: CTCAGGCTCAGTTCATCATGGA adk rv: AGTTTGCCAGCATCCATAATGTC
PCR conditions: 10 minutes at 95 degrees Celsius 40 x 30 seconds at 95 degrees Celsius 45 seconds at 59 degrees Celsius 45 seconds at 68 degrees Celsius
Stefan Roediger, Claudia Deutschmann, Claudia Zelck (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Mao, F., Leung, W.-Y., Xin, X., 2007. Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7, 76.
data(C316.amp) str(C316.amp)data(C316.amp) str(C316.amp)
A melting curve for adk was performed.
data("C316.melt.hr")data("C316.melt.hr")
A data frame with 40 observations on the following 97 variables. The first column ("T") contains the temperature (resolution: 0.2 degrees Celsius / step) and consecutive columns contain the replicates ("A01" to "H12").
adk was amplified in the Bio-Rad iQ5. After PCR, the temperature-dependent change of fluorescence was simultaneously monitored (EvaGreen, Mao et al. 2007). The primer sequences for adk were taken from this study.
adk fw: CTCAGGCTCAGTTCATCATGGA adk rv: AGTTTGCCAGCATCCATAATGTC
PCR conditions: C316.amp
Stefan Roediger, Claudia Deutschmann, Claudia Zelck (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Mao, F., Leung, W.-Y., Xin, X., 2007. Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7, 76.
data(C316.melt.hr) str(C316.melt.hr)data(C316.melt.hr) str(C316.melt.hr)
A melting curve for adk was performed.
data("C316.melt.lr")data("C316.melt.lr")
A data frame with 40 observations on the following 97 variables. The first column ("T") contains the temperature (resolution: 0.5 degrees Celsius / step) and consecutive columns contain the replicates ("A01" to "H12").
adk was amplified in the Bio-Rad iQ5. After PCR, the temperature-dependent change of fluorescence was simultaneously monitored (EvaGreen, Mao et al. 2007). The primer sequences for adk were taken from this study.
adk fw: CTCAGGCTCAGTTCATCATGGA adk rv: AGTTTGCCAGCATCCATAATGTC
PCR conditions: C316.amp
Stefan Roediger, Claudia Deutschmann, Claudia Zelck (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Mao, F., Leung, W.-Y., Xin, X., 2007. Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7, 76.
data(C316.melt.lr) str(C316.melt.lr)data(C316.melt.lr) str(C316.melt.lr)
A quantitative real-time PCR of adk was performed.
data("C317.amp")data("C317.amp")
A data frame with 40 observations on the following 97 variables. The first column ("Cycle") contains the number of cycles and consecutive columns contain the replicates ("A01" to "H12").
adk was amplified in the Bio-Rad CFX96. The change of fluorescence was simultaneously monitored (EvaGreen, Mao et al. 2007). The primer sequences for adk were taken from this study.
gDNA: 28.43 ng/microL DNA concentration, 260/280 ratio= 1.96
adk fw: CTCAGGCTCAGTTCATCATGGA adk rv: AGTTTGCCAGCATCCATAATGTC
PCR conditions: 10 minutes at 95 degrees Celsius 40 x 30 seconds at 95 degrees Celsius 45 seconds at 59 degrees Celsius 45 seconds at 68 degrees Celsius
Stefan Roediger, Claudia Deutschmann, Claudia Zelck (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Mao, F., Leung, W.-Y., Xin, X., 2007. Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7, 76.
data(C317.amp) str(C317.amp)data(C317.amp) str(C317.amp)
A melting curve for adk was performed.
data("C317.melt.hr")data("C317.melt.hr")
A data frame with 40 observations on the following 97 variables. The first column ("Temperature") contains the temperature (resolution: 0.1 degrees Celsius / step) and consecutive columns contain the replicates ("A1" to "H12").
adk was amplified in the Bio-Rad CFX96. After PCR, the temperature-dependent change of fluorescence was simultaneously monitored (EvaGreen, Mao et al. 2007). The primer sequences for adk were taken from this study.
adk fw: CTCAGGCTCAGTTCATCATGGA adk rv: AGTTTGCCAGCATCCATAATGTC
PCR conditions: C317.amp
Stefan Roediger, Claudia Deutschmann, Claudia Zelck (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Mao, F., Leung, W.-Y., Xin, X., 2007. Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7, 76.
data(C317.melt.hr) str(C317.melt.hr)data(C317.melt.hr) str(C317.melt.hr)
A melting curve for adk was performed.
data("C317.melt.lr")data("C317.melt.lr")
A data frame with 40 observations on the following 97 variables. The first column ("Temperature") contains the temperature (resolution: 0.5 degrees Celsius / step) and consecutive columns contain the replicates ("A1" to "H12").
adk was amplified in the Bio-Rad CFX96. After PCR, the temperature-dependent change of fluorescence was simultaneously monitored (EvaGreen, Mao et al. 2007). The primer sequences for adk were taken from this study.
adk fw: CTCAGGCTCAGTTCATCATGGA adk rv: AGTTTGCCAGCATCCATAATGTC
PCR conditions: C317.amp
Stefan Roediger, Claudia Deutschmann, Claudia Zelck (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Mao, F., Leung, W.-Y., Xin, X., 2007. Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7, 76.
data(C317.melt.lr) str(C317.melt.lr)data(C317.melt.lr) str(C317.melt.lr)
qPCR Experiment for the amplification of MLC-2v using the 'VideoScan' heating/cooling-unit
data(C54)data(C54)
A data frame with 56 observations on the following 4 variables.
CycleCycle number
D1Stock concentration of input cDNA
D21/10 diluted stock cDNA
D31/100 diluted stock cDNA
The aim was to amplify MLC-2v in the 'VideoScan' and to monitor with a hydrolysis probe for MLC-2v. The primer sequences for MLC-2v were taken from Roediger et al. (2013). The amplification was detected in solution of the '1 HCU' (see Roediger et al. 2013 for details). A 20 micro L PCR reaction was composed of 250 nM primer (forward and reverse), 1x Maxima Probe qPCR Master Mix (Fermentas), 1 micro L template (MLC-2v amplification product in different dilutions), 50 nM hydrolysis probe probe for MLC-2v and A. bidest. During the amplification, fluorescence was measured at 59.5 degree Celsius. The Cy5 channel was used to monitor the MLC-2v specific hydrolysis probe. Input stock cDNA was used undiluted (D1). D2 was 1/1000 and D3 1/1000000 diluted in A. bidest. The D1, D2, and D3 have different numbers measure points and D2 contains a missing value at cycle 37.
Stefan Roediger, Claudia Deutschmann
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
data(C54) str(C54) plot(NA, NA, xlim = c(0,56), ylim = c(0, 0.7), xlab = "Cycle", ylab = "refMFI") apply(C54[, c(2:4)], 2, function(x) lines(C54[, 1], x))data(C54) str(C54) plot(NA, NA, xlim = c(0,56), ylim = c(0, 0.7), xlab = "Cycle", ylab = "refMFI") apply(C54[, c(2:4)], 2, function(x) lines(C54[, 1], x))
Dilution experiment and metling curve (C60.melt) for
the human genes MLC-2v and Vimentin (see Roediger et al. 2013) using the
Roch Light Cycler 1.5.
data(C60.amp)data(C60.amp)
A data frame with 45 observations on the following 33 variables.
IndexIndex of Cycles
Vim.0.1Vimentin water control
Vim.0.2Vimentin water control
Vim.1.1Vimentin 10^-3 diluted
Vim.1.2Vimentin 10^-3 diluted
Vim.2.1Vimentin 10^-4 diluted
Vim.2.2Vimentin 10^-4 diluted
Vim.3.1Vimentin 10^-5 diluted
Vim.3.2Vimentin 10^-5 diluted
Vim.4.1Vimentin 10^-6 diluted
Vim.4.2Vimentin 10^-6 diluted
Vim.5.1Vimentin 10^-7 diluted
Vim.5.2Vimentin 10^-7 diluted
Vim.6.1Vimentin 10^-8 diluted
Vim.6.2Vimentin 10^-8 diluted
Vim.7.1Vimentin 10^-9 diluted
Vim.7.2Vimentin 10^-9 diluted
MLC2v.1.1MLC-2v 10^-3 diluted
MLC2v.1.2MLC-2v 10^-3 diluted
MLC2v.2.1MLC-2v 10^-4 diluted
MLC2v.2.2MLC-2v 10^-4 diluted
MLC2v.3.1MLC-2v 10^-5 diluted
MLC2v.3.2MLC-2v 10^-5 diluted
MLC2v.4.1MLC-2v 10^-6 diluted
MLC2v.4.2MLC-2v 10^-6 diluted
MLC2v.5.1MLC-2v 10^-7 diluted
MLC2v.5.2MLC-2v 10^-7 diluted
MLC2v.6.1MLC-2v 10^-8 diluted
MLC2v.6.2MLC-2v 10^-8 diluted
MLC2v.7.1MLC-2v 10^-9 diluted
MLC2v.7.2MLC-2v 10^-9 diluted
MLC2v.0.1MLC-2v water control
MLC2v.0.2MLC-2v water control
MLC-2v and Vimentin were amplified in the Roche Light Cycler 1.5. Decadic dilutions of the input cDNA were prepared. The change of fluorescence was simultaneously monitored with EvaGreen. The primer sequences for MLC-2v were taken from Roediger et al. (2013). A 10 micro L qPCR reaction was composed of 250 nM primer (forward and reverse), Roche qPCR Master-Mix (according to the manufactures recommendations) and 1 micro L input DNA. EvaGreen was used at 1x final. During the amplification was monitored 58 degrees Celsius. Temperature profile:
95 deg C for 8 minutes 40 x 95 deg C for 10 sec 58 deg C for 15 sec 69 deg C for 25 sec
Stefan Roediger, Claudia Deutschmann (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Mao, F., Leung, W.-Y., Xin, X., 2007. Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7, 76.
## data(C60.amp) str(C60.amp)## data(C60.amp) str(C60.amp)
Melting curves were continuously monitored with the Light Cycler 1.5 (Roche). For details on sample preparation refer to C60.amp.
data(C60.melt)data(C60.melt)
A data frame with 128 observations on the following 65 variables. Refer to C60.amp for details of the specific samples.
IndexIndex of elements
Vim.0.1.TTemperature
Vim.0.1.FFluorescence
Vim.0.2.TTemperature
Vim.0.2.FFluorescence
Vim.1.1.TTemperature
Vim.1.1.FFluorescence
Vim.1.2.TTemperature
Vim.1.2.FFluorescence
Vim.2.1.TTemperature
Vim.2.1.FFluorescence
Vim.2.2.TTemperature
Vim.2.2.FFluorescence
Vim.3.1.TTemperature
Vim.3.1.FFluorescence
Vim.3.2.TTemperature
Vim.3.2.FFluorescence
Vim.4.1.TTemperature
Vim.4.1.FFluorescence
Vim.4.2.TTemperature
Vim.4.2.FFluorescence
Vim.5.1.TTemperature
Vim.5.1.FFluorescence
Vim.5.2.TTemperature
Vim.5.2.FFluorescence
Vim.6.1.TTemperature
Vim.6.1.FFluorescence
Vim.6.2.TTemperature
Vim.6.2.FFluorescence
Vim.7.1.TTemperature
Vim.7.1.FFluorescence
Vim.7.2.TTemperature
Vim.7.2.FFluorescence
MLC2v.1.1.TTemperature
MLC2v.1.1.FFluorescence
MLC2v.1.2.TTemperature
MLC2v.1.2.FFluorescence
MLC2v.2.1.TTemperature
MLC2v.2.1.FFluorescence
MLC2v.2.2.TTemperature
MLC2v.2.2.FFluorescence
MLC2v.3.1.TTemperature
MLC2v.3.1.FFluorescence
MLC2v.3.2.TTemperature
MLC2v.3.2.FFluorescence
MLC2v.4.1.TTemperature
MLC2v.4.1.FFluorescence
MLC2v.4.2.TTemperature
MLC2v.4.2.FFluorescence
MLC2v.5.1.TTemperature
MLC2v.5.1.FFluorescence
MLC2v.5.2.TTemperature
MLC2v.5.2.FFluorescence
MLC2v.6.1.TTemperature
MLC2v.6.1.FFluorescence
MLC2v.6.2.TTemperature
MLC2v.6.2.FFluorescence
MLC2v.7.1.TTemperature
MLC2v.7.1.FFluorescence
MLC2v.7.2.TTemperature
MLC2v.7.2.FFluorescence
MLC2v.0.1.TTemperature
MLC2v.0.1.FFluorescence
MLC2v.0.2.TTemperature
MLC2v.0.2.FFluorescence
Melting curves were continuously monitored with the Light Cycler 1.5 (Roche).
Stefan Roediger, Claudia Deutschmann (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Mao, F., Leung, W.-Y., Xin, X., 2007. Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7, 76.
## data(C60.melt) str(C60.melt)## data(C60.melt) str(C60.melt)
A Helicase Dependent Amplification (HDA) of HPRT1 (Homo sapiens hypoxanthine phosphoribosyltransferase 1) was performed at three different input DNA quantities using the Bio-Rad iQ5 thermo cycler. The HDA was performed at 65 degrees Celsius. The optimal temperature for a HDA is circa 65 degrees Celsius. Lower temperatures will affect the slope and plateau of the HDA amplification curve.
data(C67)data(C67)
A data frame with 43 observations on the following 6 variables.
Cycles.C67a numeric vector containing the cycle numbers
t.C67a numeric vector containing the time elapsed between the cycles. The time was calculated by the cycle duration of one iQ5 thermocycler step (71 seconds / step).
D1Dilution 1.
D2Dilution 2.
D3Dilution 3.
D4Dilution 4.
To perform an isothermal amplification in 'VideoScan', standard conditions for the IsoAmp(R) III Universal tHDA Kit (Biohelix) were used. The reaction was composed of 12.5 micro L buffer A containing 1.25 micro L 10x reaction buffer, 150 nM primer (forward and reverse), 0.75 micro L template (synthetic) and A. bidest which was covered with 50 micro L mineral oil. The primer sequences for HPRT1 were taken from Roediger et al. (2013). Preincubation: This mixture was incubated for 2 min at 95 degree. Celsius and immediately placed on ice. 12.5 micro L of reaction buffer B which was composed of 1.25 micro L 10x buffer, 40 mM NaCl, 5 mM MgSO4, 1.75 micro L dNTPs, 0.2 x EvaGreen, 1 micro L Enzyme mix and A. bidest. The fluorescence measurement started directly after adding buffer B and the preincubation step. Temperature profile if the iQ5 thermo cycler (after Preincubation): - 60 seconds at 65 degrees Celsius - 11 seconds at 55 degrees Celsius && Measurement
Claudia Deutschmann & Stefan Roediger, BTU Cottbus - Senftenberg, Senftenberg, Germany
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
data(C67) ## maybe str(C67) ; plot(C67) ...data(C67) ## maybe str(C67) ; plot(C67) ...
A Helicase Dependent Amplification (HDA) of pCNG1 was performed. The 'VideoScan' Platform (Roediger et al. (2013)) was used to monitor the amplification. The HDA was performed at 65 degrees Celsius. Two concentrations of input DNA were used.
data(C81)data(C81)
A data frame with 351 observations on the following 5 variables.
CycleCycles HDA measurements.
t.D1Dilution 1, elapsed time during HDA in seconds.
MFI.D1Dilution 1, fluorescence.
t.D2Dilution 2, elapsed time during HDA in seconds.
MFI.D2Dilution 2, fluorescence.
To perform an isothermal amplification in 'VideoScan', standard conditions for the IsoAmp(R) III Universal tHDA Kit (Biohelix) were used. The reaction was composed of reaction mix A)10 micro L A. bidest, 1.25 micro L 10xbuffer, 0.75 micro L primer(150 nM final), 0.5 micro L template plasmid. Preincubation: This mixture was incubated for 2 min at 95 degree. Celsius and immediately placed on ice. Reaction mix B) 5 micro L A. bidest., 1.25 micro L 10x buffer, 2 micro L NaCl, 1.25 micro L MgSO4, 1.75 micro L dNTPs, 0.25 micro L EvaGreen, 1 micro L enzyme mix. The mix was covered with 50 micro L mineral oil. The fluorescence measurement in 'VideoScan' 'HCU' started directly after adding buffer B at 65 degrees Celsius. A 1x (D1) and a 1:10 dilution (D2) were tested. Temperature profile (after Preincubation): - 60 seconds at 65 degrees Celsius - 11 seconds at 55 degrees Celsius && Measurement
Claudia Deutschmann & Stefan Roediger, BTU Cottbus - Senftenberg, Senftenberg, Germany
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
data(C81) # First example # Comparison of Lowess, Moving average and splines to smooth amplification curve # data of # HDA for pCNG1. plot(NA, NA, xlim = c(0, 120), ylim = c(0, 1.2), xlab = "Time [min]", ylab = "Fluorescence", main = "VideScan HCU HDA amplification - Raw data") points(C81[, 2]/60, C81[, 3], type = "b", col = 1, pch = 20) points(C81[, 4]/60, C81[, 5], type = "b", col = 2, pch = 20) legend(2000, 0.4, c("D1", "D2"), col = c(1,2), pch = rep(20,2))data(C81) # First example # Comparison of Lowess, Moving average and splines to smooth amplification curve # data of # HDA for pCNG1. plot(NA, NA, xlim = c(0, 120), ylim = c(0, 1.2), xlab = "Time [min]", ylab = "Fluorescence", main = "VideScan HCU HDA amplification - Raw data") points(C81[, 2]/60, C81[, 3], type = "b", col = 1, pch = 20) points(C81[, 4]/60, C81[, 5], type = "b", col = 2, pch = 20) legend(2000, 0.4, c("D1", "D2"), col = c(1,2), pch = rep(20,2))
A Helicase Dependent Amplification (HDA) of Vimentin (Vim) was performed. The 'VideoScan' Platform (Roediger et al. (2013)) was used to monitor the amplification. The HDA was performed at 65 degrees Celsius. Three concentrations of input DNA (D1, D2, D3) were used.
data(C85)data(C85)
A data frame with 301 observations on the following 5 variables.
CycleCycles HDA measurements.
t.D1Dilution 1, elapsed time during HDA in seconds.
MFI.D1Dilution 1, fluorescence.
t.D2Dilution 2, elapsed time during HDA in seconds.
MFI.D2Dilution 2, fluorescence.
t.D3Dilution 3, elapsed time during HDA in seconds.
MFI.D3Dilution 3, fluorescence.
To perform an isothermal amplification in 'VideoScan', standard conditions for the IsoAmp(R) III Universal tHDA Kit (Biohelix) were used. Primers and templates are described in Roediger et al. (2013). The reaction was composed of reaction mix A)10 micro L A. bidest, 1.25 micro L 10xbuffer, 0.75 micro L primer(150nM final), 0.5 micro L template plasmid. Preincubation: This mixture was incubated for 2 min at 95 degree. Celsius and immediately placed on ice. Reaction mix B) 5 micro L A. bidest., 1.25 micro L 10x buffer, 2 micro L NaCl, 1.25 micro L MgSO4, 1.75 micro L dNTPs, 0.25 micro L EvaGreen, 1 micro L enzyme mix. The mix was covered with 50 micro L mineral oil. The fluorescence measurement in 'VideoScan' 'HCU' started directly after adding buffer B at 65 degrees Celsius. A 1x (D1), a 1:10 dilution (D2) and a 1:100 (D3) dilution were tested. Temperature profile (after Preincubation): - 60 seconds at 65 degrees Celsius - 11 seconds at 55 degrees Celsius && Measurement
Claudia Deutschmann & Stefan Roediger, BTU Cottbus - Senftenberg, Senftenberg, Germany
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
data(C85) # First example plot(NA, NA, xlim = c(0,85), ylim = c(0,1), xlab = "Time [min]", ylab = "Fluorescence", main = "HDA amplification") points(C85[, 2]/60, C85[, 3], type = "b", col = 1, pch = 20) points(C85[, 4]/60, C85[, 5], type = "b", col = 2, pch = 20) points(C85[, 6]/60, C85[, 7], type = "b", col = 3, pch = 20) legend(40, 0.5, c("D1, 1x", "D2, 1:10", "D3, 1:100"), col = c(1:3), pch = rep(20,3)) # Second example plot(NA, NA, xlim = c(0,30), ylim = c(0,0.8), xlab = "Time [min]", ylab = "Fluorescence", main = "HDA amplification") points(C85[, 2]/60, C85[, 3], type = "b", col = 1, pch = 20) points(C85[, 2]/60, smoother(C85[, 2]/60, C85[, 3], method = list("savgol")), type = "b", col = 2, pch = 20) points(C85[, 2]/60, smoother(C85[, 2]/60, C85[, 3], method = list("smooth")), type = "b", col = 3, pch = 20) points(C85[, 2]/60, smoother(C85[, 2]/60, C85[, 3], method = list("mova")), type = "b", col = 4, pch = 20) legend(1, 0.8, c("D1, raw", "D1, savgol", "D1, smooth", "D1, mova"), col = c(1:4), pch = rep(20,4)) # Third example # Comparison of Lowess, Moving average and splines to smooth amplification # curve data of # a HDA using the 'VideoScan' 'HCU' for amplification and monitoring. xrange <- 2:2400 plot(NA, NA, xlim = c(0,85), ylim = c(0.4, 0.8), xlab = "Time [min]", ylab = "RFI", main = "Raw data") points(C85[, 2]/60, C85[, 3], type = "b", col = 1, pch = 20) points(C85[, 4]/60, C85[, 5], type = "b", col = 2, pch = 20) points(C85[, 6]/60, C85[, 7], type = "b", col = 3, pch = 20) legend("topleft", c("D1, 1x", "D2, 1:10", "D3, 1:100"), col = c(1:3), pch = rep(20,3)) mtext("A", cex = 2, side = 3, adj = 0, font = 2) plot(NA, NA, xlim = c(0,40), ylim = c(-0.05, 0.3), xlab = "Time [min]", ylab = "RFI", main = "Moving average") movaww <- seq(1,17,4) for (i in 1:length(movaww)) { for (j in c(2,4,6)) { tmp <- data.frame(na.omit(C85[xrange, j])/60, na.omit(C85[xrange, j + 1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(mova = list(movaww = movaww[i])), bg.outliers = TRUE) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } mtext("B", cex = 2, side = 3, adj = 0, font = 2) legend("topleft", c("D1, 1x", "D2, 1:10", "D3, 1:100"), col = c(1:3), pch = rep(20,3)) legend("bottomright", 6, paste("movaww : ", movaww), pch = 20, lwd = 2, col = 1:length(movaww)) plot(NA, NA, xlim = c(0,40), ylim = c(-0.05, 0.3), xlab = "Time [min]", ylab = "RFI", main = "Cubic Spline") df.fact <- seq(0.5,0.9,0.1) for (i in 1:length(df.fact)) { for (j in c(2,4,6)) { tmp <- data.frame(na.omit(C85[xrange, j])/60, na.omit(C85[xrange, j + 1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(smooth = list(df.fact = df.fact[i])), bg.outliers = TRUE) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } mtext("C", cex = 2, side = 3, adj = 0, font = 2) legend("topleft", c("D1, 1x", "D2, 1:10", "D3, 1:100"), col = c(1:3), pch = rep(20,3)) legend("bottomright", paste("df.fact : ", df.fact), pch = 20, lwd = 2, col = 1:length(df.fact)) plot(NA, NA, xlim = c(0,40), ylim = c(-0.05, 0.3), xlab = "Time [min]", ylab = "RFI", main = "Lowess") f <- seq(0.01,0.2,0.04) for (i in 1:length(f)) { for (j in c(2,4,6)) { tmp <- data.frame(na.omit(C85[xrange, j])/60, na.omit(C85[xrange, j + 1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(lowess = list(f = f[i])), bg.outliers = TRUE) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } mtext("D", cex = 2, side = 3, adj = 0, font = 2) legend("topleft", c("D1, 1x", "D2, 1:10", "D3, 1:100"), col = c(1:3), pch = rep(20,3)) legend("bottomright", paste("f : ", f), pch = 20, lwd = 2, col = 1:length(f)) plot(NA, NA, xlim = c(0,40), ylim = c(-0.05, 0.3), xlab = "Time [min]", ylab = "RFI", main = "Friedman's\n''super smoother''") span <- seq(0.01,0.05,0.01) for (i in 1:length(span)) { for (j in c(2,4,6)) { tmp <- data.frame(na.omit(C85[xrange, j])/60, na.omit(C85[xrange, j + 1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(supsmu = list(span = span[i])), bg.outliers = TRUE) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } mtext("E", cex = 2, side = 3, adj = 0, font = 2) legend("topleft", c("D1, 1x", "D2, 1:10", "D3, 1:100"), col = c(1:3), pch = rep(20,3)) legend("bottomright", paste("span : ", span), pch = 20, lwd = 2, col = 1:length(span)) plot(NA, NA, xlim = c(0,40), ylim = c(-0.05, 0.3), xlab = "Time [min]", ylab = "RFI", main = "Savitzky-Golay") for (j in c(2,4,6)) { tmp <- data.frame(na.omit(C85[xrange, j])/60, na.omit(C85[xrange, j + 1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list("savgol"), bg.outliers = TRUE) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = 1) } mtext("F", cex = 2, side = 3, adj = 0, font = 2) legend("bottomright", paste("/ : ", NULL), pch = 20, lwd = 2, col = 1:length(span))data(C85) # First example plot(NA, NA, xlim = c(0,85), ylim = c(0,1), xlab = "Time [min]", ylab = "Fluorescence", main = "HDA amplification") points(C85[, 2]/60, C85[, 3], type = "b", col = 1, pch = 20) points(C85[, 4]/60, C85[, 5], type = "b", col = 2, pch = 20) points(C85[, 6]/60, C85[, 7], type = "b", col = 3, pch = 20) legend(40, 0.5, c("D1, 1x", "D2, 1:10", "D3, 1:100"), col = c(1:3), pch = rep(20,3)) # Second example plot(NA, NA, xlim = c(0,30), ylim = c(0,0.8), xlab = "Time [min]", ylab = "Fluorescence", main = "HDA amplification") points(C85[, 2]/60, C85[, 3], type = "b", col = 1, pch = 20) points(C85[, 2]/60, smoother(C85[, 2]/60, C85[, 3], method = list("savgol")), type = "b", col = 2, pch = 20) points(C85[, 2]/60, smoother(C85[, 2]/60, C85[, 3], method = list("smooth")), type = "b", col = 3, pch = 20) points(C85[, 2]/60, smoother(C85[, 2]/60, C85[, 3], method = list("mova")), type = "b", col = 4, pch = 20) legend(1, 0.8, c("D1, raw", "D1, savgol", "D1, smooth", "D1, mova"), col = c(1:4), pch = rep(20,4)) # Third example # Comparison of Lowess, Moving average and splines to smooth amplification # curve data of # a HDA using the 'VideoScan' 'HCU' for amplification and monitoring. xrange <- 2:2400 plot(NA, NA, xlim = c(0,85), ylim = c(0.4, 0.8), xlab = "Time [min]", ylab = "RFI", main = "Raw data") points(C85[, 2]/60, C85[, 3], type = "b", col = 1, pch = 20) points(C85[, 4]/60, C85[, 5], type = "b", col = 2, pch = 20) points(C85[, 6]/60, C85[, 7], type = "b", col = 3, pch = 20) legend("topleft", c("D1, 1x", "D2, 1:10", "D3, 1:100"), col = c(1:3), pch = rep(20,3)) mtext("A", cex = 2, side = 3, adj = 0, font = 2) plot(NA, NA, xlim = c(0,40), ylim = c(-0.05, 0.3), xlab = "Time [min]", ylab = "RFI", main = "Moving average") movaww <- seq(1,17,4) for (i in 1:length(movaww)) { for (j in c(2,4,6)) { tmp <- data.frame(na.omit(C85[xrange, j])/60, na.omit(C85[xrange, j + 1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(mova = list(movaww = movaww[i])), bg.outliers = TRUE) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } mtext("B", cex = 2, side = 3, adj = 0, font = 2) legend("topleft", c("D1, 1x", "D2, 1:10", "D3, 1:100"), col = c(1:3), pch = rep(20,3)) legend("bottomright", 6, paste("movaww : ", movaww), pch = 20, lwd = 2, col = 1:length(movaww)) plot(NA, NA, xlim = c(0,40), ylim = c(-0.05, 0.3), xlab = "Time [min]", ylab = "RFI", main = "Cubic Spline") df.fact <- seq(0.5,0.9,0.1) for (i in 1:length(df.fact)) { for (j in c(2,4,6)) { tmp <- data.frame(na.omit(C85[xrange, j])/60, na.omit(C85[xrange, j + 1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(smooth = list(df.fact = df.fact[i])), bg.outliers = TRUE) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } mtext("C", cex = 2, side = 3, adj = 0, font = 2) legend("topleft", c("D1, 1x", "D2, 1:10", "D3, 1:100"), col = c(1:3), pch = rep(20,3)) legend("bottomright", paste("df.fact : ", df.fact), pch = 20, lwd = 2, col = 1:length(df.fact)) plot(NA, NA, xlim = c(0,40), ylim = c(-0.05, 0.3), xlab = "Time [min]", ylab = "RFI", main = "Lowess") f <- seq(0.01,0.2,0.04) for (i in 1:length(f)) { for (j in c(2,4,6)) { tmp <- data.frame(na.omit(C85[xrange, j])/60, na.omit(C85[xrange, j + 1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(lowess = list(f = f[i])), bg.outliers = TRUE) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } mtext("D", cex = 2, side = 3, adj = 0, font = 2) legend("topleft", c("D1, 1x", "D2, 1:10", "D3, 1:100"), col = c(1:3), pch = rep(20,3)) legend("bottomright", paste("f : ", f), pch = 20, lwd = 2, col = 1:length(f)) plot(NA, NA, xlim = c(0,40), ylim = c(-0.05, 0.3), xlab = "Time [min]", ylab = "RFI", main = "Friedman's\n''super smoother''") span <- seq(0.01,0.05,0.01) for (i in 1:length(span)) { for (j in c(2,4,6)) { tmp <- data.frame(na.omit(C85[xrange, j])/60, na.omit(C85[xrange, j + 1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(supsmu = list(span = span[i])), bg.outliers = TRUE) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } mtext("E", cex = 2, side = 3, adj = 0, font = 2) legend("topleft", c("D1, 1x", "D2, 1:10", "D3, 1:100"), col = c(1:3), pch = rep(20,3)) legend("bottomright", paste("span : ", span), pch = 20, lwd = 2, col = 1:length(span)) plot(NA, NA, xlim = c(0,40), ylim = c(-0.05, 0.3), xlab = "Time [min]", ylab = "RFI", main = "Savitzky-Golay") for (j in c(2,4,6)) { tmp <- data.frame(na.omit(C85[xrange, j])/60, na.omit(C85[xrange, j + 1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list("savgol"), bg.outliers = TRUE) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = 1) } mtext("F", cex = 2, side = 3, adj = 0, font = 2) legend("bottomright", paste("/ : ", NULL), pch = 20, lwd = 2, col = 1:length(span))
The capillary convective PCR (ccPCR) is a modified device of the ccPCR system proposed by Chou et al. 2011.
data(capillaryPCR)data(capillaryPCR)
A data frame with 1844 observations on the following 10 variables.
t.121205Elapsed time during amplification
ED.121205a numeric vector
t.121128Elapsed time during amplification
ED.121128a numeric vector
t.121130.1Elapsed time during amplification
ED.121130.1a numeric vector
t.121130.2Elapsed time during amplification
ED.121130.2a numeric vector
t.121130.3Elapsed time during amplification
ED.121130.3a numeric vector
Modified version of the capillary convective tube isothermal heater heater by Chou et al. 2011. As heating system a conventional block heat was used. On the top of the heating block, we placed for the uptake of the capillaries an aluminum block (8 mm height) in which four holes (3.2 mm diameter and 3.0 mm depth with round shaped bottom) were drilled. The capillaries are regular 100 micro L Roche LightCycler(R). These glass capillaries have a round shaped closed bottom (2.3 mm inner diameter and 3.2 mm outer diameter). An "ESE-Log" detector (QIAGEN Lake Constance) was used for the real time fluorescent measurements, which was mounted in a distance of 5-10 mm next to the capillary. The PCR was performed with SYBR(R) Green fluorescent intercalating dye. Thereof the ESE-Log has in one channel the excitation at 470 nm and the detection at 520 nm. The data was recorded by the FL Digital Software (QIAGEN Lake Constance) and the exported text based raw data.
Ralf Himmelreich, IMM, Mainz, Germany
Chou, W., Chen, P., Miao Jr, M., Kuo, L., Yeh, S. and Chen, P. (2011). Rapid DNA amplification in a capillary tube by natural convection with a single isothermal heater. Biotech. 50, 52-57.
# First example data(capillaryPCR) plot(NA, NA, xlim = c(0,80), ylim = c(0,1300), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR - Raw Data") for (i in c(1,3,5,7)) { lines(capillaryPCR[, i], capillaryPCR[, i+1], type = "b", pch = 20) } abline(h = 290, v = c(18, 23, 35)) legend(60,800, c("Run 1", "Run 2", "Run 3", "Control"), pch = 20, lwd = 2) # Second example par(mfrow = c(2,1)) type <- c("mova", "spline", "savgol") plot(NA, NA, xlim = c(0,80), ylim = c(0,1100), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR with mova, spline and savgol") for (i in 1:3) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.sm <- smoother(tmp[, 1], tmp[, 2], method = list(type[i])) lines(data.frame(tmp[, 1], tmp.sm), type = "b", pch = 20, cex = 0.5, col = i) } } abline(h = 200, v = c(17.5, 21.3, 32.9)) legend(0, 1000, c("mova", "spline", "savgol"), pch = 20, lwd = 2, col = c(1:3)) plot(NA, NA, xlim = c(10,40), ylim = c(50,300), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR with mova, spline and savgol") for (i in 1:3) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.sm <- smoother(tmp[, 1], tmp[, 2], method = list(type[i])) lines(data.frame(tmp[, 1], tmp.sm), type = "b", pch = 20, cex = 0.5, col = i) } } abline(h = 200, v = c(17.5, 21.3, 32.9)) legend(10, 300, c("mova", "spline", "savgol"), pch = 20, lwd = 2, col = c(1:3)) par(mfrow = c(1,1)) # Third example method <- c("lowess","mova","savgol","smooth","spline", "supsmu") plot(NA, NA, xlim = c(0,100), ylim = c(-50,1100), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "capillary convective PCR") for (i in 1:length(method)) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.sm <- smoother(tmp[, 1], tmp[, 2], method = list(method[i])) lines(data.frame(tmp[, 1], tmp.sm), type = "l", pch = 20, cex = 0.5, col = i) } } legend(0,1000, method, pch = 20, lwd = 2, col = 1:length(method)) par(fig = c(0.5,1,0.25,0.8), new = TRUE) plot(NA, NA, xlim = c(10,40), ylim = c(50,300), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "") for (i in 1:length(method)) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.sm <- smoother(tmp[, 1], tmp[, 2], method = list(method[i])) lines(data.frame(tmp[, 1], tmp.sm), type = "l", pch = 20, cex = 0.5, col = i) } } legend(0,1000, method, pch = 20, lwd = 2, col = 1:length(method)) # Fourth example # Comparison of Lowess, Moving average and splines to smooth amplification # curve data of # a capillary convective PCR. plot(NA, NA, xlim = c(10,40), ylim = c(50, 300), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR - Moving average") movaww <- seq(1,17,4) for (i in 1:length(movaww)) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(mova = list(movaww = movaww[i]))) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } text(10,300, "A)", cex = 3) legend(25,200, paste("movaww : ", movaww), pch = 20, lwd = 2, col = 1:length(movaww)) plot(NA, NA, xlim = c(10,40), ylim = c(50, 300), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR - Cubic Spline") df.fact <- seq(0.5,0.9,0.1) for (i in 1:length(df.fact)) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(smooth = list(df.fact = df.fact[i]))) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } text(10,300, "B)", cex = 3) legend(30,200, paste("df.fact : ", df.fact), pch = 20, lwd = 2, col = 1:length(df.fact)) plot(NA, NA, xlim = c(10,40), ylim = c(50, 300), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR - Lowess") f <- seq(0.01,0.2,0.04) for (i in 1:length(f)) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(lowess = list(f = f[i]))) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } text(10,300, "C)", cex = 3) legend(30,200, paste("f : ", f), pch = 20, lwd = 2, col = 1:length(f)) plot(NA, NA, xlim = c(10,40), ylim = c(50, 300), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR - Friedman's ''super smoother''") span <- seq(0.01,0.05,0.01) for (i in 1:length(span)) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(supsmu = list(span = span[i]))) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } text(10,300, "D)", cex = 3) legend(25,200, paste("span : ", f), pch = 20, lwd = 2, col = 1:length(span)) par(mfrow = c(1,1), cex = 1)# First example data(capillaryPCR) plot(NA, NA, xlim = c(0,80), ylim = c(0,1300), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR - Raw Data") for (i in c(1,3,5,7)) { lines(capillaryPCR[, i], capillaryPCR[, i+1], type = "b", pch = 20) } abline(h = 290, v = c(18, 23, 35)) legend(60,800, c("Run 1", "Run 2", "Run 3", "Control"), pch = 20, lwd = 2) # Second example par(mfrow = c(2,1)) type <- c("mova", "spline", "savgol") plot(NA, NA, xlim = c(0,80), ylim = c(0,1100), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR with mova, spline and savgol") for (i in 1:3) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.sm <- smoother(tmp[, 1], tmp[, 2], method = list(type[i])) lines(data.frame(tmp[, 1], tmp.sm), type = "b", pch = 20, cex = 0.5, col = i) } } abline(h = 200, v = c(17.5, 21.3, 32.9)) legend(0, 1000, c("mova", "spline", "savgol"), pch = 20, lwd = 2, col = c(1:3)) plot(NA, NA, xlim = c(10,40), ylim = c(50,300), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR with mova, spline and savgol") for (i in 1:3) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.sm <- smoother(tmp[, 1], tmp[, 2], method = list(type[i])) lines(data.frame(tmp[, 1], tmp.sm), type = "b", pch = 20, cex = 0.5, col = i) } } abline(h = 200, v = c(17.5, 21.3, 32.9)) legend(10, 300, c("mova", "spline", "savgol"), pch = 20, lwd = 2, col = c(1:3)) par(mfrow = c(1,1)) # Third example method <- c("lowess","mova","savgol","smooth","spline", "supsmu") plot(NA, NA, xlim = c(0,100), ylim = c(-50,1100), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "capillary convective PCR") for (i in 1:length(method)) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.sm <- smoother(tmp[, 1], tmp[, 2], method = list(method[i])) lines(data.frame(tmp[, 1], tmp.sm), type = "l", pch = 20, cex = 0.5, col = i) } } legend(0,1000, method, pch = 20, lwd = 2, col = 1:length(method)) par(fig = c(0.5,1,0.25,0.8), new = TRUE) plot(NA, NA, xlim = c(10,40), ylim = c(50,300), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "") for (i in 1:length(method)) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.sm <- smoother(tmp[, 1], tmp[, 2], method = list(method[i])) lines(data.frame(tmp[, 1], tmp.sm), type = "l", pch = 20, cex = 0.5, col = i) } } legend(0,1000, method, pch = 20, lwd = 2, col = 1:length(method)) # Fourth example # Comparison of Lowess, Moving average and splines to smooth amplification # curve data of # a capillary convective PCR. plot(NA, NA, xlim = c(10,40), ylim = c(50, 300), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR - Moving average") movaww <- seq(1,17,4) for (i in 1:length(movaww)) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(mova = list(movaww = movaww[i]))) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } text(10,300, "A)", cex = 3) legend(25,200, paste("movaww : ", movaww), pch = 20, lwd = 2, col = 1:length(movaww)) plot(NA, NA, xlim = c(10,40), ylim = c(50, 300), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR - Cubic Spline") df.fact <- seq(0.5,0.9,0.1) for (i in 1:length(df.fact)) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(smooth = list(df.fact = df.fact[i]))) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } text(10,300, "B)", cex = 3) legend(30,200, paste("df.fact : ", df.fact), pch = 20, lwd = 2, col = 1:length(df.fact)) plot(NA, NA, xlim = c(10,40), ylim = c(50, 300), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR - Lowess") f <- seq(0.01,0.2,0.04) for (i in 1:length(f)) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(lowess = list(f = f[i]))) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } text(10,300, "C)", cex = 3) legend(30,200, paste("f : ", f), pch = 20, lwd = 2, col = 1:length(f)) plot(NA, NA, xlim = c(10,40), ylim = c(50, 300), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR - Friedman's ''super smoother''") span <- seq(0.01,0.05,0.01) for (i in 1:length(span)) { for (j in c(1,3,5,7)) { tmp <- data.frame(na.omit(capillaryPCR[, j]), na.omit(capillaryPCR[, j+1])) tmp.out <- smoother(tmp[, 1], tmp[, 2], method = list(supsmu = list(span = span[i]))) lines(data.frame(tmp[, 1], tmp.out), type = "l", pch = 20, cex = 0.5, col = i) } } text(10,300, "D)", cex = 3) legend(25,200, paste("span : ", f), pch = 20, lwd = 2, col = 1:length(span)) par(mfrow = c(1,1), cex = 1)
Quantitative PCR (qPCR) with a hydrolysis probe and DNA binding dye (EvaGreen) (Mao et al. 2007) was performed in the 'VideoScan' heating cooling unit. The cycle-dependent increase of the fluorescence was quantified at three different temperatures in order to estimate temperature dependent effects.
data(CD74)data(CD74)
A data frame with 60 observations on the following 19 variables. refMFI (referenced Mean Fluorescence Intensity), fluorescence. Dilution A, 1x; Dilution B, 1:10; Dilution B, 1:100.
CyclePCR cycles
EG.30.ArefMFI at 30 degrees Celsius, EvaGreen, Dilution A
EG.59.5.ArefMFI at 59.5 degrees Celsius, EvaGreen, Dilution A
EG.68.5.ArefMFI at 68.5 degrees Celsius, EvaGreen, Dilution A
HP.30.ArefMFI at 30 degrees Celsius, hydrolysis probe, Dilution A
HP.59.5.ArefMFI at 59.5 degrees Celsius, hydrolysis probe, Dilution A
HP.68.5.ArefMFI at 68.5 degrees Celsius, hydrolysis probe, Dilution A
EG.30.BrefMFI at 30 degrees Celsius, EvaGreen, Dilution B
EG.59.5.BrefMFI at 59.5 degrees Celsius, EvaGreen, Dilution B
EG.68.5.BrefMFI at 68.5 degrees Celsius, EvaGreen, Dilution B
HP.30.BrefMFI at 30 degrees Celsius, hydrolysis probe, Dilution B
HP.59.5.BrefMFI at 59.5 degrees Celsius, hydrolysis probe, Dilution B
HP.68.5.BrefMFI at 68.5 degrees Celsius, hydrolysis probe, Dilution B
EG.30.CrefMFI at 30 degrees Celsius, EvaGreen, Dilution C
EG.59.5.CrefMFI at 59.5 degrees Celsius, EvaGreen, Dilution C
EG.68.5.CrefMFI at 68.5 degrees Celsius, EvaGreen, Dilution C
HP.30.CrefMFI at 30 degrees Celsius, hydrolysis probe, Dilution C
HP.59.5.CrefMFI at 59.5 degrees Celsius, hydrolysis probe, Dilution C
HP.68.5.CrefMFI at 68.5 degrees Celsius, hydrolysis probe, Dilution C
The aim was to amplify MLC-2v in the 'VideoScan' platform while the intercalating dye EvaGreen and a hydrolysis probe for MLC-2v were used simultaneously. The primer sequences for MLC-2v were taken from Roediger et al. (2013). The amplification was detected in solution of the '1 HCU' (see Roediger et al. 2013 for details). A 20 micro L PCR reaction was composed of 500 nM primer (forward and reverse), 1x Maxima Probe qPCR Master Mix (Fermentas), 1 micro L template (MLC-2v amplification product in different dilutions), 50 nM hydrolysis probe probe for MLC-2v, 0.5 x EvaGreen and A. bidest. During the amplification, fluorescence was measured at 3 different temperatures, at 59.5 degrees Celsius the annealing temperature, at 68.5 degree Celsius the elongation temperature and at 30 degrees Celsius. The FAM channel was used to monitor EvaGreen and the Cy5 channel to monitor the MLC-2v specific hydrolysis probe.
Claudia Deutschmann & Stefan Roediger, BTU Cottbus - Senftenberg, Senftenberg, Germany
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
Mao, F., Leung, W.-Y., Xin, X., 2007. Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7, 76.
# First example # Comparison of smoothers and filter on amplification curves # Amplification curves were measured at three temperature (30, # 59.5, 68.5 degrees Celsius) using the 'VideoScan' 'HCU' (see # Roediger et al. 2013 for details). MLC-2v was amplified. # The change of fluorescence was monitored by the intercalating # dye EvaGreen and hydrolysis probes. data(CD74) par(mfrow = c(1,2)) plot(NA, NA, xlim = c(1,30), ylim = c(0,2), xlab = "Cycle", ylab = "MFI", main = "VideoScan HCU\nRaw Data") lim <- 1:30 for (j in c(2:4)) { for (i in seq(j,19,6)) { lines(CD74[lim, 1], CD74[lim, i], col = 1) } } for (j in c(5:7)) { for (i in seq(j,19,6)) { lines(CD74[lim, 1], CD74[lim, i], col = 2) } } plot(NA, NA, xlim = c(1,30), ylim = c(0,1.8), xlab = "Cycle", ylab = "MFI", main = "VideoScan HCU\nSmoothed Data") lim <- 1:30 for (j in c(2:4)) { for (i in seq(j,19,6)) { lines(CD74[lim, 1], smoother(CD74[lim, 1], CD74[lim, i], trans = TRUE), col = 1) } } for (j in c(5:7)) { for (i in seq(j,19,6)) { lines(CD74[lim, 1], smoother(CD74[lim, 1], CD74[lim, i], trans = TRUE), col = 2) } } par(mfrow = c(1,1))# First example # Comparison of smoothers and filter on amplification curves # Amplification curves were measured at three temperature (30, # 59.5, 68.5 degrees Celsius) using the 'VideoScan' 'HCU' (see # Roediger et al. 2013 for details). MLC-2v was amplified. # The change of fluorescence was monitored by the intercalating # dye EvaGreen and hydrolysis probes. data(CD74) par(mfrow = c(1,2)) plot(NA, NA, xlim = c(1,30), ylim = c(0,2), xlab = "Cycle", ylab = "MFI", main = "VideoScan HCU\nRaw Data") lim <- 1:30 for (j in c(2:4)) { for (i in seq(j,19,6)) { lines(CD74[lim, 1], CD74[lim, i], col = 1) } } for (j in c(5:7)) { for (i in seq(j,19,6)) { lines(CD74[lim, 1], CD74[lim, i], col = 2) } } plot(NA, NA, xlim = c(1,30), ylim = c(0,1.8), xlab = "Cycle", ylab = "MFI", main = "VideoScan HCU\nSmoothed Data") lim <- 1:30 for (j in c(2:4)) { for (i in seq(j,19,6)) { lines(CD74[lim, 1], smoother(CD74[lim, 1], CD74[lim, i], trans = TRUE), col = 1) } } for (j in c(5:7)) { for (i in seq(j,19,6)) { lines(CD74[lim, 1], smoother(CD74[lim, 1], CD74[lim, i], trans = TRUE), col = 2) } } par(mfrow = c(1,1))
Helicase Dependent Amplification in the 'VideoScan' 'HCU' of HPRT1 (Homo sapiens hypoxanthine phosphoribosyltransferase 1)
data(CD75)data(CD75)
A data frame with 93 observations on the following 6 variables. The data frame contains three replicates of a HDA for HPRT1.
CD75.t1Elapsed time during HDA in seconds.
CD75.F1Time-dependent fluorescence during HDA.
CD75.t2Elapsed time during HDA in seconds.a numeric vector
CD75.F2Time-dependent fluorescence during HDA
CD75.t3Elapsed time during HDA in seconds.
CD75.F3Time-dependent fluorescence during HDA.
To perform an isothermal amplification in 'VideoScan', standard conditions for the IsoAmp(R) III Universal tHDA Kit (Biohelix) were used. The reaction was composed of 12.5 micro L buffer A containing 1.25 micro L 10x reaction buffer, 150 nM primer (forward and reverse), 0.75 micro L template (synthetic) and A. bidest which was covered with 50 micro L mineral oil. The primer sequences for HPRT1 were taken from Roediger et al. (2013). Preincubation: This mixture was incubated for 2 min at 95 degree. Celsius and immediately placed on ice. 12.5 micro L of reaction buffer B which was composed of 1.25 micro L 10x buffer, 40 mM NaCl, 5 mM MgSO4, 1.75 micro L dNTPs, 0.2 x EvaGreen, 1 micro L Enzyme mix and A. bidest. The fluorescence measurement in 'VideoScan' 'HCU' started directly after adding buffer B at 55, 60 or 65 degrees Celsius and revealed optimal conditions for the amplification when using 60 or 65 degree Celsius. Temperature profile (after Preincubation): - 60 seconds at 65 degrees Celsius - 11 seconds at 55 degrees Celsius && Measurement
Claudia Deutschmann & Stefan Roediger, BTU Cottbus - Senftenberg, Senftenberg, Germany
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
data(CD75) ## maybe str(CD75) ; plot(CD75) ...data(CD75) ## maybe str(CD75) ; plot(CD75) ...
chipPCR package
The chipPCR package contains numerous data sets from commercial and
experimental technologies for the amplification of nucleic acids. The data
sets include results from qPCR experiments with the 'VideoScan' 'HCU'
(Roediger et al. 2013), Bio-Rad (iQ5, CFX96), capillary convective PCR (ccPCR) and
Roche Light Cycler 1.5. Real-time monitored amplification reactions were
performed using standard amplification methods (qPCR, based on Taq
polymerase) and quantitative isothermal amplification (qIA). In selected
data
sets are melting curves and dilution series available. Most of the data
sets have equidistant measure points. However, some datasets have none
homogeneous measure points as indicated below.
capillary convective PCR (ccPCR)
capillaryPCR:
The capillary convective PCR (ccPCR) is a modified device of the ccPCR
system proposed by Chou et al. 2013.
standard qPCR - commercial thermo cyclers
C60.amp:
qPCR Experiment for the Amplification of MLC-2v and Vimentin (as decadic
dilutions) Using the Roche Light Cycler 1.5.
C60.melt:
Melt Curves MLC-2v and Vimentin for the qPCR experiment
C60.amp using the Roche Light Cycler 1.5
C126EG595:
A quantitative PCR (qPCR) with the DNA binding dye (EvaGreen) (Mao et al.
2007) was performed in a Bio-Rad iQ5 thermo cycler. The
cycle-dependent increase of the fluorescence was quantified at the
elongation step (59.5 degrees Celsius).
C126EG685:
A quantitative PCR (qPCR) with the DNA binding dye (EvaGreen) (Mao et al.
2007) was performed in a Bio-Rad iQ5 thermo cycler. The
cycle-dependent increase of the fluorescence was quantified at the
elongation step (68.5 degrees Celsius).
C127EGHP:
Quantitative PCR (qPCR) with a hydrolysis probe (Cy5/BHQ2) and DNA binding
dye (EvaGreen) (Mao et al. 2007) performed in the Roche Light Cycler
1.5 thermo cycler.
VIMCFX96_60:
Human vimentin amplification curve data (measured during annealing phase at
60 degrees Celsius) for 96 replicate samples in a Bio-Rad CFX96 thermo cycler.
VIMCFX96_69:
Human vimentin amplification curve data (measured during elongation phase at
69 degrees Celsius) for 96 replicate samples in a Bio-Rad CFX96 thermo cycler.
VIMCFX96_meltcurve:
Human vimentin melting curve data for 96 replicate samples in a Bio-Rad
CFX96 thermo cycler.
VIMiQ5_595:
Human vimentin amplification curve data (measured during annealing phase at
59.5 degrees Celsius) for 96 replicate samples in a Bio-Rad iQ5 thermo cycler.
VIMiQ5_685:
Human vimentin amplification curve data (measured during elongation phase at
68.5 degrees Celsius) for 96 replicate samples in a Bio-Rad iQ5 thermo cycler.
VIMiQ5_melt:
Human vimentin melting curve data for 96 replicate samples in a Bio-Rad
iQ5 thermo cycler.
standard qPCR - experimental thermo cyclers
C54:
qPCR Experiment in the 'VideoScan' heating/cooling-unit for the
amplification using different concentrations of MLC-2v input cDNA
quantities.
CD74:
Quantitative PCR with a hydrolysis probe and DNA binding dye (EvaGreen) for
MLC-2v measured at 59.5 degrees Celsius (annealing temperature), 68.5
degrees Celsius (elongation temperature) and at 30 degrees Celsius.
Simulations
Eff625:
Highly replicate number amplification curves with an approximate
amplification efficiency of 62.5 percent at cycle number 18. The data were
derived from a simulation such as the AmpSim function.
Eff750:
Highly replicate number amplification curves with an approximate
amplification efficiency of 75 percent at cycle number 18. The data were
derived from a simulation such as the AmpSim function.
Eff875:
Highly replicate number amplification curves with an approximate
amplification efficiency of 87.5 percent at cycle number 18. The data were
derived from a simulation such as the AmpSim function.
Eff1000:
Highly replicate number amplification curves with an approximate
amplification efficiency of 100 percent at cycle number 18. The data were
derived from a simulation such as the AmpSim function.
Isothermal Amplification - Helicase Dependent Amplification
C67:
A Helicase Dependent Amplification (HDA) of HPRT1 (Homo sapiens
hypoxanthine phosphoribosyltransferase 1), performed at different
input DNA quantities using the Bio-Rad iQ5 thermo cycler.
CD75:
Helicase Dependent Amplification in the 'VideoScan' 'HCU' of HPRT1 (Homo
sapiens hypoxanthine phosphoribosyltransferase 1) measured at at 55, 60 or
65 degrees Celsius.
C81:
Helicase Dependent Amplification (HDA) of pCNG1 using the 'VideoScan'
Platform (Roediger et al. (2013)). The HDA was performed at 65 degree
Celsius. Two concentrations of input DNA were used.
C85:
Helicase Dependent Amplification (HDA) of Vimentin (Vim) in the 'VideoScan'
Platform (Roediger et al. (2013)). The HDA was performed at 65 degree
Celsius with three dilutions of input DNA.
Stefan Roediger
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
data(VIMiQ5_melt) tmp <- VIMiQ5_melt plot(NA, NA, xlim = c(55,95), ylim = c(0, 40000), xlab = "Temperature (degrees Celsius)",ylab = "RFU", main = "Melting curve in iQ5 (Bio-Rad)") apply(tmp[, 2:ncol(tmp)], 2, function(x) lines(tmp[1:nrow(tmp),1],x)) Fmean <- rowMeans(tmp[, 2:ncol(tmp)]) lines(tmp[1:nrow(tmp),1], Fmean, col = "red", lwd = 3) legend(55, 4000, c("Raw", "Mean"), pch = c(19,19), col = c(1,2))data(VIMiQ5_melt) tmp <- VIMiQ5_melt plot(NA, NA, xlim = c(55,95), ylim = c(0, 40000), xlab = "Temperature (degrees Celsius)",ylab = "RFU", main = "Melting curve in iQ5 (Bio-Rad)") apply(tmp[, 2:ncol(tmp)], 2, function(x) lines(tmp[1:nrow(tmp),1],x)) Fmean <- rowMeans(tmp[, 2:ncol(tmp)]) lines(tmp[1:nrow(tmp),1], Fmean, col = "red", lwd = 3) legend(55, 4000, c("Raw", "Mean"), pch = c(19,19), col = c(1,2))
CPP encompasses a set of functions to
pre-process an amplification curve. The pre-processing includes options to
normalize curve data, to remove background, to remove outliers
in the background range and to test if an amplification is significant.
## S4 method for signature 'numeric,numeric' CPP(x, y, smoother = TRUE, method = "savgol", trans = FALSE, method.reg = "lmrob", bg.outliers = FALSE, median = FALSE, method.norm = "none", qnL = 0.03, amptest = FALSE, manual = FALSE, nl = 0.08, bg.range = NULL, ...) ## S4 method for signature 'matrix,missing' CPP(x, y, smoother = TRUE, method = "savgol", trans = FALSE, method.reg = "lmrob", bg.outliers = FALSE, median = FALSE, method.norm = "none", qnL = 0.03, amptest = FALSE, manual = FALSE, nl = 0.08, bg.range = NULL, ...) ## S4 method for signature 'data.frame,missing' CPP(x, y, smoother = TRUE, method = "savgol", trans = FALSE, method.reg = "lmrob", bg.outliers = FALSE, median = FALSE, method.norm = "none", qnL = 0.03, amptest = FALSE, manual = FALSE, nl = 0.08, bg.range = NULL, ...)## S4 method for signature 'numeric,numeric' CPP(x, y, smoother = TRUE, method = "savgol", trans = FALSE, method.reg = "lmrob", bg.outliers = FALSE, median = FALSE, method.norm = "none", qnL = 0.03, amptest = FALSE, manual = FALSE, nl = 0.08, bg.range = NULL, ...) ## S4 method for signature 'matrix,missing' CPP(x, y, smoother = TRUE, method = "savgol", trans = FALSE, method.reg = "lmrob", bg.outliers = FALSE, median = FALSE, method.norm = "none", qnL = 0.03, amptest = FALSE, manual = FALSE, nl = 0.08, bg.range = NULL, ...) ## S4 method for signature 'data.frame,missing' CPP(x, y, smoother = TRUE, method = "savgol", trans = FALSE, method.reg = "lmrob", bg.outliers = FALSE, median = FALSE, method.norm = "none", qnL = 0.03, amptest = FALSE, manual = FALSE, nl = 0.08, bg.range = NULL, ...)
x |
is a vector containing the time or cycle values or a matrix or data frame containing both time or cycle values and fluorescence. |
y |
is a vector containing the fluorescence values. Omitted if
|
smoother |
logical parameter which indicates if smoother should be used. |
method |
a vector of names defining which smoothing method should be used. The Savitzky-Golay smoothing filter is the default smoother. Use "lowess" for LOWESS smoother (locally-weighted polynomial regression), "mova" for moving average, "savgol" for Savitzky-Golay smoothing filter, "smooth" for cubic spline smooth, "spline" for standard cubic spline smooth, "supsmu" for Friedman's SuperSmoother, "whit1" for weighted Whittaker smoothing with a first order finite difference penalty, "whit2" for weighted Whittaker smoothing with a second order finite difference penalty or "all" for all implemented smoothing algorithms. |
trans |
defines if the slope of the background range in a curve should be corrected by a linear regression. |
method.reg |
defines the method ("rfit", "lmrob", "rq") for the robust linear
regression. If equal to "least", |
bg.outliers |
is a logical argument which to remove outliers in the background range. |
median |
If set to TRUE, median is used instead of mean in outlier replacement. The mean is used by default. |
method.norm |
is a argument to use a "none", "minm", "max", "lugn", or "zscore" normalization. |
qnL |
is the quantile to be used for the quantile normalization. |
amptest |
is a logical operator which is used to set a test for a positive amplification. |
manual |
is used to test for a fixed threshold value of the background. |
nl |
is a value used as fixed threshold value for the background. |
bg.range |
is a |
... |
dot operator for diverse arguments of
|
CPP uses the bg.max function to estimate automatically the start of the
amplification process. In the background range there is often noise which
makes it harder to determine a meaningful background value. Therefore
CPP can optionally remove outliers by finding the
value with largest difference from the mean as provided by the
rm.outlier function. This function also tries to
prevent calculations of non amplified signals.
The slope of the background range is often unequal to
zero. By setting the parameter trans it is possible to apply a
simple correction of the slope. Thereby either a robust linear regression
by computing MM-type regression estimators, a nonparametric rank-based
estimator or a standard linear regression model. Care is needed when
using
trans with time series (see lm for details).
Stefan Roediger, Michal Burdukiewicz
Normalization: normalizer
Smoothing: smoother
Robust linear regression: lm.coefs
# Function to pre-process an amplification curve. # Take a subset of the C17 data frame. data(C17) par(mfrow = c(2,1)) plot(NA, NA, xlab = "Time [sec]", ylab = "refMFI", main = "HDA Raw Data", xlim = c(0, 2500), ylim = c(0,1.1), pch = 20) for (i in 3:5) { lines(C17[1:50, 1], C17[1:50, i], col = i - 2, type = "b", pch = 20) } legend(50, 0.5, c("55 degrees Celsius", "60 degrees Celsius", "65 degrees Celsius"), col = c(1,2,3), pch = rep(20,3)) # Use CPP to pre-process the data by removing the missing value and # normalization of the data plot(NA, NA, xlab = "Time [sec]", ylab = "refMFI", main = "Curve Pre-processor Applied to HDA Data", xlim = c(0, 2500), ylim = c(0,1.1), pch = 20) for (i in 3:5) { y.cpp <- CPP(C17[2:50, 1], C17[2:50, i], method.norm = "minm", bg.outliers = TRUE)$y.norm lines(C17[2:50, 1], y.cpp, col = i - 2, type = "b", pch = 20) } legend(50, 1, c("55 degrees Celsius", "60 degrees Celsius", "65 degrees Celsius"), col = c(1,2,3), pch = rep(20,3)) par(mfrow = c(1,1))# Function to pre-process an amplification curve. # Take a subset of the C17 data frame. data(C17) par(mfrow = c(2,1)) plot(NA, NA, xlab = "Time [sec]", ylab = "refMFI", main = "HDA Raw Data", xlim = c(0, 2500), ylim = c(0,1.1), pch = 20) for (i in 3:5) { lines(C17[1:50, 1], C17[1:50, i], col = i - 2, type = "b", pch = 20) } legend(50, 0.5, c("55 degrees Celsius", "60 degrees Celsius", "65 degrees Celsius"), col = c(1,2,3), pch = rep(20,3)) # Use CPP to pre-process the data by removing the missing value and # normalization of the data plot(NA, NA, xlab = "Time [sec]", ylab = "refMFI", main = "Curve Pre-processor Applied to HDA Data", xlim = c(0, 2500), ylim = c(0,1.1), pch = 20) for (i in 3:5) { y.cpp <- CPP(C17[2:50, 1], C17[2:50, i], method.norm = "minm", bg.outliers = TRUE)$y.norm lines(C17[2:50, 1], y.cpp, col = i - 2, type = "b", pch = 20) } legend(50, 1, c("55 degrees Celsius", "60 degrees Celsius", "65 degrees Celsius"), col = c(1,2,3), pch = rep(20,3)) par(mfrow = c(1,1))
"der"
An S4 class containing the output inder function.
.Data:"matrix" is a matrix containing smoothed data as well as
the first and second derivative.
method:"character" used method of smoothing.
signature(object = "der"): calculates and prints approximate first
derivative maximum, second derivative maximum, second derivative minimum and second
derivative center. See summary.der.
signature(object = "der"): prints only .Data slot of the
object.
Stefan Roediger, Michal Burdukiewicz
pcr <- AmpSim(cyc = 1:40) res <- inder(pcr[, 1], pcr[, 2]) sums <- summary(res) print(sums)pcr <- AmpSim(cyc = 1:40) res <- inder(pcr[, 1], pcr[, 2]) sums <- summary(res) print(sums)
"eff"
An S4 class containing the output effcalc function.
.Data:"matrix" containing the "Concentration", "Location"
(mean, median), "Deviation" (standard deviation, median absolute
deviation), "Coefficient of Variance" (CV, RSD) sequential in the
columns.
amplification.efficiency:"numeric" value representing
amplification efficiency.
regression:"lm" the results of the linear regression and .
correlation.test:"htest". the correlation test
(Pearson) results.
signature(x = "eff"): plots calculated efficiency.
See plot.eff
signature(object = "eff"): prints only .Data slot of the
object.
signature(object = "eff"): prints information about object
prettier than show.
Stefan Roediger, Michal Burdukiewicz
Highly replicate number amplification curves with an approximate amplification efficiency of 100 percent at cycle number 18. The data were derived from a simulation such as the AmpSim function.
data(Eff1000)data(Eff1000)
A data frame with 40 (Cycles) observations on the following 1000 (amplification curves) variables. The columns are all replicates.
data(Eff1000) plot(NA, NA, xlim = c(1,40), ylim = c(0,max(Eff1000)), xlab = "Cycle", ylab = "RFU", main = "Amplification Curves with 100 Percent Efficiency") apply(Eff1000[, 1:ncol(Eff1000)], 2, function(x) lines(1:40,x)) Fmean <- rowMeans(Eff1000[, 1:ncol(Eff1000)]) lines(1:40, Fmean, col = "red", lwd = 3) legend(1, quantile(unlist(Eff1000), 0.9), c("Raw", "Mean"), pch = c(19,19), col = c(1,2))data(Eff1000) plot(NA, NA, xlim = c(1,40), ylim = c(0,max(Eff1000)), xlab = "Cycle", ylab = "RFU", main = "Amplification Curves with 100 Percent Efficiency") apply(Eff1000[, 1:ncol(Eff1000)], 2, function(x) lines(1:40,x)) Fmean <- rowMeans(Eff1000[, 1:ncol(Eff1000)]) lines(1:40, Fmean, col = "red", lwd = 3) legend(1, quantile(unlist(Eff1000), 0.9), c("Raw", "Mean"), pch = c(19,19), col = c(1,2))
Highly replicate number amplification curves with an approximate amplification efficiency of 62.5 percent at cycle number 18. The data were derived from a simulation such as the AmpSim function.
data(Eff625)data(Eff625)
A data frame with 40 (Cycles) observations on the following 1000 (amplification curves) variables. The columns are all replicates.
data(Eff625) plot(NA, NA, xlim = c(1,40), ylim = c(0,max(Eff625)), xlab = "Cycle", ylab = "RFU", main = "Amplification Curves with 62.5 Percent Efficiency") apply(Eff625[, 1:ncol(Eff625)], 2, function(x) lines(1:40,x)) Fmean <- rowMeans(Eff625[, 1:ncol(Eff625)]) lines(1:40, Fmean, col = "red", lwd = 3) legend(1, quantile(unlist(Eff625), 0.9), c("Raw", "Mean"), pch = c(19,19), col = c(1,2))data(Eff625) plot(NA, NA, xlim = c(1,40), ylim = c(0,max(Eff625)), xlab = "Cycle", ylab = "RFU", main = "Amplification Curves with 62.5 Percent Efficiency") apply(Eff625[, 1:ncol(Eff625)], 2, function(x) lines(1:40,x)) Fmean <- rowMeans(Eff625[, 1:ncol(Eff625)]) lines(1:40, Fmean, col = "red", lwd = 3) legend(1, quantile(unlist(Eff625), 0.9), c("Raw", "Mean"), pch = c(19,19), col = c(1,2))
Highly replicate number amplification curves with an approximate amplification efficiency of 75 percent at cycle number 18. The data were derived from a simulation such as the AmpSim function.
data(Eff750)data(Eff750)
A data frame with 40 (Cycles) observations on the following 1000 (amplification curves) variables. The columns are all replicates.
data(Eff750) plot(NA, NA, xlim = c(1,40), ylim = c(0,max(Eff750)), xlab = "Cycle", ylab = "RFU", main = "Amplification Curves with 75 Percent Efficiency") apply(Eff750[, 1:ncol(Eff750)], 2, function(x) lines(1:40,x)) Fmean <- rowMeans(Eff750[, 1:ncol(Eff750)]) lines(1:40, Fmean, col = "red", lwd = 3) legend(1, quantile(unlist(Eff750), 0.9), c("Raw", "Mean"), pch = c(19,19), col = c(1,2))data(Eff750) plot(NA, NA, xlim = c(1,40), ylim = c(0,max(Eff750)), xlab = "Cycle", ylab = "RFU", main = "Amplification Curves with 75 Percent Efficiency") apply(Eff750[, 1:ncol(Eff750)], 2, function(x) lines(1:40,x)) Fmean <- rowMeans(Eff750[, 1:ncol(Eff750)]) lines(1:40, Fmean, col = "red", lwd = 3) legend(1, quantile(unlist(Eff750), 0.9), c("Raw", "Mean"), pch = c(19,19), col = c(1,2))
Highly replicate number amplification curves with an approximate amplification efficiency of 87.5 percent at cycle number 18. The data were derived from a simulation such as the AmpSim function.
data(Eff875)data(Eff875)
A data frame with 40 (Cycles) observations on the following 1000 (amplification curves) variables. The columns are all replicates.
data(Eff875) plot(NA, NA, xlim = c(1,40), ylim = c(0,max(Eff875)), xlab = "Cycle", ylab = "RFU", main = "Amplification Curves with 87.5 Percent Efficiency") apply(Eff875[, 1:ncol(Eff875)], 2, function(x) lines(1:40,x)) Fmean <- rowMeans(Eff875[, 1:ncol(Eff875)]) lines(1:40, Fmean, col = "red", lwd = 3) legend(1, quantile(unlist(Eff875), 0.9), c("Raw", "Mean"), pch = c(19,19), col = c(1,2))data(Eff875) plot(NA, NA, xlim = c(1,40), ylim = c(0,max(Eff875)), xlab = "Cycle", ylab = "RFU", main = "Amplification Curves with 87.5 Percent Efficiency") apply(Eff875[, 1:ncol(Eff875)], 2, function(x) lines(1:40,x)) Fmean <- rowMeans(Eff875[, 1:ncol(Eff875)]) lines(1:40, Fmean, col = "red", lwd = 3) legend(1, quantile(unlist(Eff875), 0.9), c("Raw", "Mean"), pch = c(19,19), col = c(1,2))
effcalc calculates the amplification efficiency of a dilution.
## S4 method for signature 'numeric,numeric' effcalc(x, y, logx = TRUE, RSD = FALSE, rob = FALSE, level = 0.95) ## S4 method for signature 'matrix,missing' effcalc(x, y, logx = TRUE, RSD = FALSE, rob = FALSE, level = 0.95) ## S4 method for signature 'matrix,missing' effcalc(x, y, logx = TRUE, RSD = FALSE, rob = FALSE, level = 0.95)## S4 method for signature 'numeric,numeric' effcalc(x, y, logx = TRUE, RSD = FALSE, rob = FALSE, level = 0.95) ## S4 method for signature 'matrix,missing' effcalc(x, y, logx = TRUE, RSD = FALSE, rob = FALSE, level = 0.95) ## S4 method for signature 'matrix,missing' effcalc(x, y, logx = TRUE, RSD = FALSE, rob = FALSE, level = 0.95)
x |
is the column of a data frame for the concentration (dilution). |
y |
are multiple columns of Cq values from a
|
logx |
is a logical parameter used to convert the concentration into a decadic logarithm. |
RSD |
Setting the option |
rob |
Using the option |
level |
Tolerance/confidence level. |
an object of the class eff.
Stefan Roediger
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
S. Mehra and W.-S. Hu. A kinetic model of quantitative real-time polymerase chain reaction. Biotechnology and bioengineering, 91(7):848–860, Sept. 2005. ISSN 0006-3592. doi: 10.1002/bit.20555. PMID: 15986490.
M. Guescini, D. Sisti, M. B. Rocchi, L. Stocchi, and V. Stocchi. A new real-time PCR method to overcome significant quantitative inaccuracy due to slight amplification inhibition. BMC Bioinformatics, 9(1):326, July 2008. ISSN 1471-2105. doi: 10.1186/1471-2105-9-326. PMID: 18667053.
A. Tichopad, M. Dilger, G. Schwarz, and M. W. Pfaffl. Standardized determination of real-time PCR efficiency from a single reaction set-up. Nucleic Acids Research, 31(20):e122, Oct. 2003. ISSN 1362-4962. PMID: 14530455 PMCID: PMC219490.
A. Staalberg, P. Aman, B. Ridell, P. Mostad, and M. Kubista. Quantitative real-time PCR method for detection of b-lymphocyte monoclonality by comparison of kappa and lambda immunoglobulin light chain expression. Clinical Chemistry, 49(1):51–59, Jan. 2003. ISSN 0009-9147. PMID: 12507960.
W. Liu and D. A. Saint. A new quantitative method of real time reverse transcription polymerase chain reaction assay based on simulation of polymerase chain reaction kinetics. Analytical Biochemistry, 302(1):52–59, Mar. 2002. ISSN 0003-2697. doi: 10.1006/abio.2001.5530. PMID: 11846375.
fixNA imputes missing values in a single
column of data. The imputation is based on a linear approximation by default.
However, the data can also be estimated from an approximation by splines.
## S4 method for signature 'numeric,numeric' fixNA(x, y, spline = TRUE, verbose = FALSE) ## S4 method for signature 'matrix,missing' fixNA(x, y, spline = TRUE, verbose = FALSE) ## S4 method for signature 'data.frame,missing' fixNA(x, y, spline = TRUE, verbose = FALSE)## S4 method for signature 'numeric,numeric' fixNA(x, y, spline = TRUE, verbose = FALSE) ## S4 method for signature 'matrix,missing' fixNA(x, y, spline = TRUE, verbose = FALSE) ## S4 method for signature 'data.frame,missing' fixNA(x, y, spline = TRUE, verbose = FALSE)
x |
|
y |
|
spline |
|
verbose |
|
Amplification data of experimental systems may contain missing values (NA).
The NAs may be caused by detector problems, acquisition error or other
assorted problems. There are different ways to handle missing values. One
approach is to ignore NAs which is generally acceptable. However, in case of
further calculation it is often necessary to handle cases of missing values in
a way that the next calculation steps can be performed. Missing values can be
eliminated by a imputation. Imputation encompasses various approaches. This
includes to calculate a location parameter (e.g., mean, median) or other
significant values (e.g., minimum, maximum, modus) of a data column. However,
in non-linear processes such as amplification processes its is better to
estimate the missing values from a trend. fixNA was empirically tested and relies on a linear
trend estimation based on the approx function. This
approach is useful but may be problematic on the phases other then background
or plateau phases of an amplification reaction. The parameter
spline on fixNA enables a trend
estimation on splines and may be more appropriate in most scenarios. Other
smoothing functions such as the Savitzky-Golay smoothing filter have the
intrinsic capability to remove missing values [Savitzky and Golay 1964,
Eilers 2003].
Stefan Roediger, Michal Burdukiewicz
Eilers, P. H. C. Anal. Chem. 2003, 75, 3631–3636. Savitzky, A.; Golay, M. J. E. Anal. Chem. 1964, 36, 1627–1639
# Simulate a qPCR reaction with AmpSim with for 40 cycles res <- AmpSim(cyc = c(1:40)) # Introduce a missing value in the transition between # the background and the exponential phase res.NA <-res res.NA[18, 2] <- NA par(mfrow = c(2,2)) plot(res, xlab = "Cycles", ylab = "Fluorescence", type = "b", pch = 20, main = "Simulation without missing value") abline(v = c(17.5, 18.5), col = "grey") abline(h = c(0.09, 0.14), col = "grey") res.NA.linear <- fixNA(res.NA[, 1], res.NA[, 2], spline = FALSE, verbose = FALSE) plot(res.NA.linear, xlab = "Cycles", ylab = "Fluorescence", type = "b", pch = 20, main = "Simulation with linear imputed\n NA value during transition") abline(v = c(17.5, 18.5), col = "grey") abline(h = c(0.09, 0.14), col = "grey") plot(res.NA, xlab = "Cycles", ylab = "Fluorescence", type = "b", pch = 20, main = "Simulation with missing\n value during transition") abline(v = c(17.5, 18.5), col = "grey") abline(h = c(0.09, 0.14), col = "grey") res.NA.spline <- fixNA(res.NA[, 1], res.NA[, 2], spline = TRUE, verbose = FALSE) plot(res.NA.spline, xlab = "Cycles", ylab = "Fluorescence", type = "b", pch = 20, main = "Simulation with spline imputed\n NA value during transition") abline(v = c(17.5, 18.5), col = "grey") abline(h = c(0.09, 0.14), col = "grey") par(mfrow = c(1,1))# Simulate a qPCR reaction with AmpSim with for 40 cycles res <- AmpSim(cyc = c(1:40)) # Introduce a missing value in the transition between # the background and the exponential phase res.NA <-res res.NA[18, 2] <- NA par(mfrow = c(2,2)) plot(res, xlab = "Cycles", ylab = "Fluorescence", type = "b", pch = 20, main = "Simulation without missing value") abline(v = c(17.5, 18.5), col = "grey") abline(h = c(0.09, 0.14), col = "grey") res.NA.linear <- fixNA(res.NA[, 1], res.NA[, 2], spline = FALSE, verbose = FALSE) plot(res.NA.linear, xlab = "Cycles", ylab = "Fluorescence", type = "b", pch = 20, main = "Simulation with linear imputed\n NA value during transition") abline(v = c(17.5, 18.5), col = "grey") abline(h = c(0.09, 0.14), col = "grey") plot(res.NA, xlab = "Cycles", ylab = "Fluorescence", type = "b", pch = 20, main = "Simulation with missing\n value during transition") abline(v = c(17.5, 18.5), col = "grey") abline(h = c(0.09, 0.14), col = "grey") res.NA.spline <- fixNA(res.NA[, 1], res.NA[, 2], spline = TRUE, verbose = FALSE) plot(res.NA.spline, xlab = "Cycles", ylab = "Fluorescence", type = "b", pch = 20, main = "Simulation with spline imputed\n NA value during transition") abline(v = c(17.5, 18.5), col = "grey") abline(h = c(0.09, 0.14), col = "grey") par(mfrow = c(1,1))
humanrater allows rating a curve for a certain characteristic in the interactive,
semi-blind manner. humanrater draws
individual graphs of a curve and prompts an input field for the user. This
function can be used to compare the human rating and the rating of a
machine.
humanrater(x, cyc = 1, repeats = 1, designations = list(y = "yes", a = "ambiguous", n = "not"), shuffle = TRUE, ...)humanrater(x, cyc = 1, repeats = 1, designations = list(y = "yes", a = "ambiguous", n = "not"), shuffle = TRUE, ...)
x |
is the input data (matrix or data.frame). |
cyc |
is the index of column containing the cycle data. |
repeats |
number of repeats to rate the samples. |
designations |
a named list of length at least 2. See Details. |
shuffle |
logical, if |
... |
additional arguments to |
A user can specify the list of designations characterizing the curve, where the names of
elements specify short designations used during rating. Defaults are y for "yes", a
for "ambiguous" and n for "no".
The supplied designation list must have length at least two (for example "true"/"false").
Michal Burdukiewicz, Stefan Roediger
testdata <- data.frame(1:35, AmpSim(Cq = 15, noise = TRUE)[, 2], AmpSim(Cq = 25, noise = TRUE)[, 2], rnorm(35), AmpSim(Cq = 35, noise = TRUE)[, 2], rnorm(35), AmpSim(Cq = 45, noise = TRUE)[, 2]) #we strongly advise against running code below using 'example(humanrater)' #due to the highly interactive nature of this function (it would not end #without user's input), it is recommended to just copy lines below into R #command line ## Not run: #check testdata for significance of amplification in two repeats human.test1 <- humanrater(testdata, repeats = 2) #check testdata for significance of amplification in one repeat and declare more #finger friendly (but less obvious) designations human.test2 <- humanrater(testdata, repeats = 1, list(q = "yes", w = "no")) ## End(Not run)testdata <- data.frame(1:35, AmpSim(Cq = 15, noise = TRUE)[, 2], AmpSim(Cq = 25, noise = TRUE)[, 2], rnorm(35), AmpSim(Cq = 35, noise = TRUE)[, 2], rnorm(35), AmpSim(Cq = 45, noise = TRUE)[, 2]) #we strongly advise against running code below using 'example(humanrater)' #due to the highly interactive nature of this function (it would not end #without user's input), it is recommended to just copy lines below into R #command line ## Not run: #check testdata for significance of amplification in two repeats human.test1 <- humanrater(testdata, repeats = 2) #check testdata for significance of amplification in one repeat and declare more #finger friendly (but less obvious) designations human.test2 <- humanrater(testdata, repeats = 1, list(q = "yes", w = "no")) ## End(Not run)
A function inder ("in" + "der" = interpolate derivatives) for
interpolating first and second derivatives using the five-point stencil.
Therefore this function can be used to estimate the Cq (cycle of
quantification) of an amplification curve. First positive derivative also
known as First Derivative Maximum (FDM) and the Second Derivative Maximum
(SDM) are calculated this way (Ruijter et al. 2013). However, from the
mathematical point of view it can also be used to calculate the melting
point for melting curve analysis (compare Roediger et al. 2013) provided
that the sign of the derivative is changed.
inder(x, y, Nip = 4, logy = FALSE, smooth.method = "spline")inder(x, y, Nip = 4, logy = FALSE, smooth.method = "spline")
x |
is a |
y |
is a vector of dependent variable. Omitted if |
Nip |
is a value which defines how often an interpolation takes place at n
equally
spaced points spanning the interval (default 4). |
logy |
If |
smooth.method |
a character vector of length 1 or |
The function y = f(x) is numerically derived using the five-point stencil.
This method does not require any assumptions regarding the function f.
A smoothing procedure greatly enhances calculating derivative calculation. inder
uses two smoothing algorithms best suited for this approach. A smoothing can
be omitted by setting smooth.method to NULL, which is advisable in case of
the already smoothed data.
An object of der class.
Stefan Roediger, Michal Burdukiewicz
Ruijter JM, Pfaffl MW, Zhao S, et al. (2013) Evaluation of qPCR curve analysis methods for reliable biomarker discovery: bias, resolution, precision, and implications. Methods San Diego Calif 59:32–46.
Surface Melting Curve Analysis with R. S. Roediger, A. Boehm and I. Schimke. The R Journal. 5(2):37–52, 2013. https://journal.r-project.org
# First example # Derive sinus x <- 1:100/10 y <- sin(x) ders <- inder(x, y) plot(x, y, type = "l") lines(ders[, "x"], ders[, "d1y"], col = "red") lines(ders[, "x"], ders[, "d2y"], col = "green") legend("topright", c("f(x)", "f'(x)", "f''(x)"), lty = 1, col = c("black", "red", "green")) # Second example # Determine the approximate second derivative maximum # for a qPCR experiment. SDM, isPCR <- AmpSim(cyc = 1:40) res <- inder(isPCR) plot(isPCR, xlab = "Cycle", ylab = "RFU", ylim = c(-0.15,1), main = "Approximate Second Derivative Maximum (SDM)", type = "b", pch = 20) lines(res[, "x"], res[, "d1y"], col = "blue") lines(res[, "x"], res[, "d2y"], col = "red") summ <- summary(res, print = FALSE) abline(v = c(summ["SDM"], summ["SDm"], summ["SDC"]), col = c(3,4,5)) text(summ["SDM"], 0.5, paste0("SDM ~ ", round(summ["SDM"], 2)), cex = 1.5, col = 3) text(summ["SDC"], 0.7, paste0("SDC ~ ", round(summ["SDC"], 2)), cex = 1.5, col = 5) text(summ["SDm"], 0.9, paste0("SDm ~ ", round(summ["SDm"], 2)), cex = 1.5, col = 4) text(summ["FDM"] + 10, 0.65, paste("FDM ~ ", round(summ["FDM"], 2)), cex = 1.5, col = 1) legend(1, 1, c("raw", "first derivative", "second derivative"), col = c(1,4,2), lty = c(2,1,1), cex = 1.2)# First example # Derive sinus x <- 1:100/10 y <- sin(x) ders <- inder(x, y) plot(x, y, type = "l") lines(ders[, "x"], ders[, "d1y"], col = "red") lines(ders[, "x"], ders[, "d2y"], col = "green") legend("topright", c("f(x)", "f'(x)", "f''(x)"), lty = 1, col = c("black", "red", "green")) # Second example # Determine the approximate second derivative maximum # for a qPCR experiment. SDM, isPCR <- AmpSim(cyc = 1:40) res <- inder(isPCR) plot(isPCR, xlab = "Cycle", ylab = "RFU", ylim = c(-0.15,1), main = "Approximate Second Derivative Maximum (SDM)", type = "b", pch = 20) lines(res[, "x"], res[, "d1y"], col = "blue") lines(res[, "x"], res[, "d2y"], col = "red") summ <- summary(res, print = FALSE) abline(v = c(summ["SDM"], summ["SDm"], summ["SDC"]), col = c(3,4,5)) text(summ["SDM"], 0.5, paste0("SDM ~ ", round(summ["SDM"], 2)), cex = 1.5, col = 3) text(summ["SDC"], 0.7, paste0("SDC ~ ", round(summ["SDC"], 2)), cex = 1.5, col = 5) text(summ["SDm"], 0.9, paste0("SDm ~ ", round(summ["SDm"], 2)), cex = 1.5, col = 4) text(summ["FDM"] + 10, 0.65, paste("FDM ~ ", round(summ["FDM"], 2)), cex = 1.5, col = 1) legend(1, 1, c("raw", "first derivative", "second derivative"), col = c(1,4,2), lty = c(2,1,1), cex = 1.2)
Real-time amplification plot of a Loop-mediated isothermal amplification (LAMP) by Tanner et al.(2012) in a CFX96 Real Time System (Bio-Rad Laboratories, Hercules, CA, USA).
data("LAMP")data("LAMP")
A data frame with 115 observations on the following 2 variables.
TimeTime in minutes
Normalized.RFURFU (Normalized)
The data were digitized as described by Poisot (2011). The image for data extraction was taken from Figure 4B by Tanner et al.(2012). For further experimental and technical details refer to Tanner et al.(2012).
The original data were taken from Figure 4B by Tanner et al.(2012).
Poisot, T. (2011). The digitize Package: Extracting Numerical Data from Scatterplots. The R Journal 3, 25–26.
Tanner, N.A., Zhang, Y., and Evans, T.C. (2012). Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. BioTechniques 53, 81–89.
plot(LAMP, main = "LAMP by Tanner et al.(2012)", xlab = "Time (minutes)", ylab = "RFU (Normalized)", col = "red", type = "l") abline(h = 0.05, lty = 2, col = "grey") legend("bottomright", c("E. coli (Cy5)"), col = "red", pch = 19)plot(LAMP, main = "LAMP by Tanner et al.(2012)", xlab = "Time (minutes)", ylab = "RFU (Normalized)", col = "red", type = "l") abline(h = 0.05, lty = 2, col = "grey") legend("bottomright", c("E. coli (Cy5)"), col = "red", pch = 19)
Computes linear model using the robust linear regression.
lm.coefs(x, y, method.reg)lm.coefs(x, y, method.reg)
x |
a vector of ordinate values. |
y |
a vector of abscissa values. |
method.reg |
defines the method ("rfit", "lmrob", "rq", "least") for the linear regression. |
lm.coefs is a convenient wrapper around few functions performing
normal (least squares) and robust linear regression. If the robust linear
regression is impossible, lm.coefs will give a warning and perform linear
regression using the least squares method.
This function can be used to calculate the background of an amplification
curve. The coefficients of the analysis can be used for a trend based
correction of the entire data set.
A data frame with one column and two rows representing coefficients of the linear model.
Stefan Roediger, Michal Burdukiewicz
plot(VIMCFX96_69[, 1], VIMCFX96_69[, 2], type = "l", xlab = "Cycle", ylab = "Fluorescence") rect(1,0,10,5000) method <- c("lmrob", "rq", "least", "rfit") for (i in 1:4) { tmp <- lm.coefs(VIMCFX96_69[1:10, 1], VIMCFX96_69[1:10, 2], method.reg = method[i]) abline(a = tmp[1, 1], b = tmp[2, 1], col = i + 1, lwd = 1.5) } legend(2, 3000, c("Data", "lmrob", "rq", "least", "rfit"), lty = 1, col = 1:5, cex = 1.5)plot(VIMCFX96_69[, 1], VIMCFX96_69[, 2], type = "l", xlab = "Cycle", ylab = "Fluorescence") rect(1,0,10,5000) method <- c("lmrob", "rq", "least", "rfit") for (i in 1:4) { tmp <- lm.coefs(VIMCFX96_69[1:10, 1], VIMCFX96_69[1:10, 2], method.reg = method[i]) abline(a = tmp[1, 1], b = tmp[2, 1], col = i + 1, lwd = 1.5) } legend(2, 3000, c("Data", "lmrob", "rq", "least", "rfit"), lty = 1, col = 1:5, cex = 1.5)
MFIaggr is used for a fast multiple comparison of the cycle dependent variance of the fluorescence.
## S4 method for signature 'numeric,numeric' MFIaggr(x, y, cyc = 1, fluo = 2:ncol(x), RSD = FALSE, rob = FALSE, llul = c(1,10)) ## S4 method for signature 'matrix,missing' MFIaggr(x, y, cyc = 1, fluo = 2:ncol(x), RSD = FALSE, rob = FALSE, llul = c(1,10)) ## S4 method for signature 'data.frame,missing' MFIaggr(x, y, cyc = 1, fluo = 2:ncol(x), RSD = FALSE, rob = FALSE, llul = c(1,10))## S4 method for signature 'numeric,numeric' MFIaggr(x, y, cyc = 1, fluo = 2:ncol(x), RSD = FALSE, rob = FALSE, llul = c(1,10)) ## S4 method for signature 'matrix,missing' MFIaggr(x, y, cyc = 1, fluo = 2:ncol(x), RSD = FALSE, rob = FALSE, llul = c(1,10)) ## S4 method for signature 'data.frame,missing' MFIaggr(x, y, cyc = 1, fluo = 2:ncol(x), RSD = FALSE, rob = FALSE, llul = c(1,10))
x |
is the column of a data frame for the cycle or data.frame/matrix with whole data. |
y |
are multiple columns of fluorescence values from a
|
cyc |
is the index of column containing the cycle data.
Used only if |
fluo |
are the columns containing the fluorescence data.
Used only if |
RSD |
Setting the option |
rob |
Using the option |
llul |
is a parameter to define the lower and upper data limit (cycle), aka region of interest (ROI) used for the density and quantile plot. |
An object of the class refMFI. refMFI means referenced
Mean Fluorescence Intensity (Roediger et al. 2013).
Stefan Roediger, Michal Burdukiewicz
Roediger S, Boehm A, Schimke I. Surface Melting Curve Analysis with R. The R Journal 2013;5:37–53.
# First Example # Cycle dependent variance of the refMFI using standard measures # (Mean, Standard Deviation (SD)). # Use Standard Deviation (SD) in the plot data(VIMCFX96_60) MFIaggr(VIMCFX96_60[, 1], VIMCFX96_60[, 2:ncol(VIMCFX96_60)]) #alternative usage MFIaggr(VIMCFX96_60) #only second and forth column plot(MFIaggr(VIMCFX96_60, fluo = c(2, 4))) # Example # Use of MFIaggr to test for heteroskedasticity using the Breusch-Pagan # test. The data were aggregated with the MFIaggr function and assigned to # the object res. The standard deviation was transformed to the variance. # The plot shows the cycle dependent variance. # First cycles 1 to 10 of 96 qPCR replicate amplification curves were # analyzed. Next the cycles 1 to 40 of the same amplification curve data # were analyzed. The Breusch-Pagan confirmed the heteroskedasticity in the # amplification curve data. par(mfrow = c(1,2), bty = "n") res <- MFIaggr(VIMCFX96_60[, 1], VIMCFX96_60[, 2:ncol(VIMCFX96_60)], llul = c(1,10)) head(res) plot(res[, 1], res[, 3]^2, xlab = "Cycle", ylab = "Variance of refMFI", xlim = c(1,10), main = "ROI from Cycle 1 to 10", pch = 19, type = "b") abline(v = c(1,10), col = "grey", lty = 2, lwd = 2) legend("top", paste0("Breusch-Pagan test p-value: \n", format(summary(res)[5], digits = 2)), bty = "n") res <- MFIaggr(VIMCFX96_60[, 1], VIMCFX96_60[, 2:ncol(VIMCFX96_60)], llul = c(1,40)) head(res) plot(res[, 1], res[, 3]^2, xlab = "Cycle", ylab = "Variance of refMFI", main = "ROI from Cycle 1 to 40", pch = 19, type = "b") abline(v = c(1,40), col = "grey", lty = 2, lwd = 2) legend("top", paste0("Breusch-Pagan test p-value: \n", format(summary(res)[5], digits = 2)), bty = "n") par(mfrow = c(1,2))# First Example # Cycle dependent variance of the refMFI using standard measures # (Mean, Standard Deviation (SD)). # Use Standard Deviation (SD) in the plot data(VIMCFX96_60) MFIaggr(VIMCFX96_60[, 1], VIMCFX96_60[, 2:ncol(VIMCFX96_60)]) #alternative usage MFIaggr(VIMCFX96_60) #only second and forth column plot(MFIaggr(VIMCFX96_60, fluo = c(2, 4))) # Example # Use of MFIaggr to test for heteroskedasticity using the Breusch-Pagan # test. The data were aggregated with the MFIaggr function and assigned to # the object res. The standard deviation was transformed to the variance. # The plot shows the cycle dependent variance. # First cycles 1 to 10 of 96 qPCR replicate amplification curves were # analyzed. Next the cycles 1 to 40 of the same amplification curve data # were analyzed. The Breusch-Pagan confirmed the heteroskedasticity in the # amplification curve data. par(mfrow = c(1,2), bty = "n") res <- MFIaggr(VIMCFX96_60[, 1], VIMCFX96_60[, 2:ncol(VIMCFX96_60)], llul = c(1,10)) head(res) plot(res[, 1], res[, 3]^2, xlab = "Cycle", ylab = "Variance of refMFI", xlim = c(1,10), main = "ROI from Cycle 1 to 10", pch = 19, type = "b") abline(v = c(1,10), col = "grey", lty = 2, lwd = 2) legend("top", paste0("Breusch-Pagan test p-value: \n", format(summary(res)[5], digits = 2)), bty = "n") res <- MFIaggr(VIMCFX96_60[, 1], VIMCFX96_60[, 2:ncol(VIMCFX96_60)], llul = c(1,40)) head(res) plot(res[, 1], res[, 3]^2, xlab = "Cycle", ylab = "Variance of refMFI", main = "ROI from Cycle 1 to 40", pch = 19, type = "b") abline(v = c(1,40), col = "grey", lty = 2, lwd = 2) legend("top", paste0("Breusch-Pagan test p-value: \n", format(summary(res)[5], digits = 2)), bty = "n") par(mfrow = c(1,2))
MFIaggr.gui is a Graphical User Interface based on the shiny
package. The core if this GUI is based on the Comparison of the
MFIaggr function. The cycle dependent variance can
be analyzed intuitively. This GUI dynamically generates reports.
MFIaggr.gui()MFIaggr.gui()
Any ad-blocking software may be cause of malfunctions.
Stefan Roediger, Michal Burdukiewicz.
# The code chunk below will fail if the web browser is not installed. if on UNIX platform try: # as.vector(Sys.getenv("R_BROWSER")) # Invoke the shiny AmpSim app in the default browser ## Not run: #do not execute using example(), it breaks the sequence of the plots in shiny app MFIaggr.gui() ## End(Not run)# The code chunk below will fail if the web browser is not installed. if on UNIX platform try: # as.vector(Sys.getenv("R_BROWSER")) # Invoke the shiny AmpSim app in the default browser ## Not run: #do not execute using example(), it breaks the sequence of the plots in shiny app MFIaggr.gui() ## End(Not run)
normalizer normalizes any data set using a chosen method (see Details).
It may be used when the data from an experiment have considerable variation regarding the
background and plateau signal.
normalizer(y, method.norm = "none", qnL = 0.03)normalizer(y, method.norm = "none", qnL = 0.03)
y |
is a vector containing the fluorescence values. |
method.norm |
is a argument to use a "none", "minm", "max", "luqn", or "zscore" normalization. See Details. |
qnL |
is the quantile to be used for the quantile normalization. Ignored if
|
The parameter qnL is
a user defined quantile which is used for the quantile normalization. A
quantile normalization herein refers to an approach which is less prone to
outliers than a normalization based on the minimum and the maximum of an
amplification curve.
minm does a min-max normalization between 0 and 1 (see Roediger et al.
2013 for explanation).
max does a normalization to the maximum value (MFI/max(MFI)).
luqn does a quantile normalization based on a symmetric proportion
as defined by the qnL parameter (e.g., qnL = 0.03 equals 3 and 97
percent quantiles).
zscore performs a z-score normalization with a mean of 0 and a
standard deviation of 1.
A vector of normalized fluorescence values.
Stefan Roediger, Michal Burdukiewicz
Surface Melting Curve Analysis with R. S. Roediger, A. Boehm and I. Schimke. The R Journal. 5(2):37–52, 2013. https://journal.r-project.org
normalizer(C17[2L:50, 1], "minm")normalizer(C17[2L:50, 1], "minm")
bg objects
Draws diagnostic plots of amplification reaction.
## S4 method for signature 'bg' plot(x, what = 1:3, add = FALSE, indicators = TRUE, legend = TRUE, stan.labs = TRUE, plot.colors = c("black", "red", "blue"), ...)## S4 method for signature 'bg' plot(x, what = 1:3, add = FALSE, indicators = TRUE, legend = TRUE, stan.labs = TRUE, plot.colors = c("black", "red", "blue"), ...)
x |
is a |
what |
is a vector specifying what should be plotted. |
add |
is a |
indicators |
is a |
legend |
is a |
stan.labs |
is a |
plot.colors |
is a vectors of colors used in plot. Must have length 3. |
... |
Arguments to be passed further to the plot function, such as graphical parameters. |
plot.bg is simplified, ready-to-use version of
plot.der, which still can be used whenever more
flexible function is needed.
Stefan Roediger, Michal Burdukiewicz
#step-by-step plotting bg object res <- AmpSim(cyc = 1:40, Cq = 25) background <- bg.max(res) plot(background) #above is equivalent of below plot(rounder(inder(res)), xlab = "Cycles", ylab = "Fluorescence", pch = 20, legend = FALSE) abline(v = slot(background, "bg.start")) text(slot(background, "bg.start"), 0.2, "Background start", pos = 4) abline(v = slot(background, "bg.stop"), col = "blue") text(slot(background, "bg.stop"), 0.25, "Background stop", pos = 4, col = "blue") abline(v = slot(background, "amp.stop"), col = "green") text(slot(background, "amp.stop"), 0.3, "Plateau transition", pos = 4, col = "green") legend(4, 1, c("Raw data", "First derivative", "Second derivative"), pch = rep(20, 3), col = c(1, 2, 4))#step-by-step plotting bg object res <- AmpSim(cyc = 1:40, Cq = 25) background <- bg.max(res) plot(background) #above is equivalent of below plot(rounder(inder(res)), xlab = "Cycles", ylab = "Fluorescence", pch = 20, legend = FALSE) abline(v = slot(background, "bg.start")) text(slot(background, "bg.start"), 0.2, "Background start", pos = 4) abline(v = slot(background, "bg.stop"), col = "blue") text(slot(background, "bg.stop"), 0.25, "Background stop", pos = 4, col = "blue") abline(v = slot(background, "amp.stop"), col = "green") text(slot(background, "amp.stop"), 0.3, "Plateau transition", pos = 4, col = "green") legend(4, 1, c("Raw data", "First derivative", "Second derivative"), pch = rep(20, 3), col = c(1, 2, 4))
der objects
Plots interpolated derivatives.
## S4 method for signature 'der' plot(x, what = 1:3, add = FALSE, legend = TRUE, plot.colors = c("black", "red", "blue"), ...)## S4 method for signature 'der' plot(x, what = 1:3, add = FALSE, legend = TRUE, plot.colors = c("black", "red", "blue"), ...)
x |
is a |
what |
is a vector specifying what should be plotted. |
add |
is a |
legend |
is a |
plot.colors |
is a vectors of colors used in plot. Must have length 3 for the original function, first, and second derivative, respectively. |
... |
Arguments to be passed further to the plot function, such as graphical parameters. |
Stefan Roediger, Michal Burdukiewicz
res <- inder(AmpSim(cyc = 1:40, Cq = 25)) plot(res) #round the result of inder plot(rounder(res))res <- inder(AmpSim(cyc = 1:40, Cq = 25)) plot(res) #round the result of inder plot(rounder(res))
eff objects
Draws diagnostic plots of the amplification efficiency.
## S4 method for signature 'eff' plot(x, xlab = "log10(Concentration)", ylab = "Cq", main = "Efficiency Plot", trend = TRUE, res.fit = "topright", CI = FALSE, level = 0.95, type = "p", pch = 19, er.length = 0.05, col = "black")## S4 method for signature 'eff' plot(x, xlab = "log10(Concentration)", ylab = "Cq", main = "Efficiency Plot", trend = TRUE, res.fit = "topright", CI = FALSE, level = 0.95, type = "p", pch = 19, er.length = 0.05, col = "black")
x |
is a |
xlab |
a title for the x axis. |
ylab |
a title for the y axis. |
main |
an overall title for the plot. |
trend |
Setting the option |
res.fit |
If |
.
CI |
Setting the option |
level |
Tolerance/confidence level. |
type |
is a graphical parameter setting the plot use lines, points
or both (see |
pch |
is a graphical parameter used to define the symbol used in the plot. |
er.length |
|
col |
|
The plot being a result of this function is built from three subplots.
Stefan Roediger, Michal Burdukiewicz
Roediger S, Boehm A, Schimke I. Surface Melting Curve Analysis with R. The R Journal 2013;5:37–53.
refMFI objects
Draw quick diagnostic plots of amplification reaction.
## S4 method for signature 'refMFI' plot(x, CV = FALSE, type = "p", pch = 19, length = 0.05, col = "black") ## S4 method for signature 'refMFI,refMFI' plot(x, y, CV = FALSE, type = "p", pch = 19, length = 0.05, col = "black")## S4 method for signature 'refMFI' plot(x, CV = FALSE, type = "p", pch = 19, length = 0.05, col = "black") ## S4 method for signature 'refMFI,refMFI' plot(x, y, CV = FALSE, type = "p", pch = 19, length = 0.05, col = "black")
x |
is a |
y |
optionally an additional |
CV |
If |
type |
is a graphical parameter setting the plot use lines, points
or both (see |
pch |
is a graphical parameter used to define the symbol used in the plot. |
length |
|
col |
|
This function is a relative of the MFIerr function from the MBmca package
(Roediger et al. 2013, The R Journal). The plot being a result of this
function is built from three subplots. If y parameter is
not absent, it is plotted in lighter color than x.
Stefan Roediger, Michal Burdukiewicz
Roediger S, Boehm A, Schimke I. Surface Melting Curve Analysis with R. The R Journal 2013;5:37–53.
Plots many curves on one plot in table-like fashion.
plotCurves(x, y, cyc = 1, fluo = 2:ncol(x), one.plot = FALSE, nrow = ceiling(sqrt(ncol(y))), CPP = FALSE, ...)plotCurves(x, y, cyc = 1, fluo = 2:ncol(x), one.plot = FALSE, nrow = ceiling(sqrt(ncol(y))), CPP = FALSE, ...)
x |
is the column of a data frame for the cycle or data.frame/matrix with whole data. |
y |
are multiple columns of fluorescence values from a
|
cyc |
is the index of column containing the cycle data.
Used only if |
fluo |
are the columns containing the fluorescence data.
Used only if |
one.plot |
|
nrow |
number of rows in plot. Applies only if |
CPP |
logical, if |
... |
additional arguments to |
plotCurves is a function for the quick assessment of amplification
curve raw data in an orthogonal matrix.
None.
Stefan Roediger, Michal Burdukiewicz, Konstantin A. Blagodatskikh
# First example plotCurves(VIMCFX96_60[, 1], VIMCFX96_60[, 2L:16], type = "l") # Second example y <- VIMCFX96_60[, 2L:16] # Introduce some missing values. y[c(1,4,5,6,23,34), c(2,4,9,15)] <- NA plotCurves(VIMCFX96_60[, 1], y, nrow = 4, type = "l") # Third example # Same as second example but the CPP option is set to TRUE. # Noise and missing values will be removed. y <- VIMCFX96_60[, 2L:16] # Introduce some missing values. y[c(1,4,5,6,23,34), c(2,4,9,15)] <- NA plotCurves(VIMCFX96_60[, 1], y, nrow = 4, CPP = TRUE, type = "l") # Fourth example plotCurves(VIMCFX96_60, y = NULL, one.plot = TRUE, type = "l") plotCurves(VIMCFX96_60, y = NULL, one.plot = FALSE, type = "l")# First example plotCurves(VIMCFX96_60[, 1], VIMCFX96_60[, 2L:16], type = "l") # Second example y <- VIMCFX96_60[, 2L:16] # Introduce some missing values. y[c(1,4,5,6,23,34), c(2,4,9,15)] <- NA plotCurves(VIMCFX96_60[, 1], y, nrow = 4, type = "l") # Third example # Same as second example but the CPP option is set to TRUE. # Noise and missing values will be removed. y <- VIMCFX96_60[, 2L:16] # Introduce some missing values. y[c(1,4,5,6,23,34), c(2,4,9,15)] <- NA plotCurves(VIMCFX96_60[, 1], y, nrow = 4, CPP = TRUE, type = "l") # Fourth example plotCurves(VIMCFX96_60, y = NULL, one.plot = TRUE, type = "l") plotCurves(VIMCFX96_60, y = NULL, one.plot = FALSE, type = "l")
"refMFI"
An S4 class containing the output MFIaggr function.
refMFI means referenced Mean Fluorescence Intensity (Roediger et al. 2013)
.Data:"matrix" containing the "Cycle",
"Location"
(mean, median), "Deviation" (standard deviation, median absolute
deviation), "Coefficient of Variance" (CV, RSD) sequential in the
columns.
density:"density" containing results of the
density analysis.
qqnorm.data:"data.frame" containing data required
for
Quantile-Quantile plots.
stats:"numeric" vector containing general
statistics.
signature(y = "refMFI"): plots a normal QQ
plot.
See qqnorm
signature(y = "refMFI"): adds a line to QQ plot.
See qqline
signature(x = "refMFI"): plots the
object. See plot.refMFI
signature(object = "refMFI"): prints only
.Data slot of the
object.
signature(object = "refMFI"): prints general
statistics and
allows easy access to stats slot. See
summary.refMFI
Stefan Roediger, Michal Burdukiewicz
Roediger S, Boehm A, Schimke I. Surface Melting Curve Analysis with R. The R Journal 2013;5:37–53.
MFIaggr, plot.refMFI,
summary.refMFI
data(VIMCFX96_60) res <- MFIaggr(VIMCFX96_60) #summarize analysis summary(res) #plot results of the analysis plot(res) #plot a QQ plot qqnorm(res) #add QQ line qqline(res)data(VIMCFX96_60) res <- MFIaggr(VIMCFX96_60) #summarize analysis summary(res) #plot results of the analysis plot(res) #plot a QQ plot qqnorm(res) #add QQ line qqline(res)
inder calculates numeric derivatives on
smoothed data which results in data points not observable in reality. The
rounder function averages such result to the real values of cycle
number.
rounder(object, cyc = 1)rounder(object, cyc = 1)
object |
a class |
cyc |
a column containing cycle numbers after smoothing. In case of objects
created by the |
An object of the class der containing cycle number and
averaged values of the fluorescence, first derivative and second
derivative.
Stefan Roediger, Michal Burdukiewicz
isPCR <- AmpSim(cyc = 1:40) res <- inder(isPCR) rd <- rounder(res) plot(rd)isPCR <- AmpSim(cyc = 1:40) res <- inder(isPCR) rd <- rounder(res) plot(rd)
Real-time amplification plot of an Recombinase Polymerase Amplification (RPA) by Lutz et al.(2009) in a centrifugal microfluidic foil cartridge.
data("RPA")data("RPA")
A data frame with 184 observations on the following 2 variables.
Reaction.TimeReaction Time [min]
RFURelative fluorescence units [RFU]
The data were digitized as described by Poisot (2011). The image for data extraction was taken from Figure 3b by Lutz et al.(2009). The amplification curve present the results of a cross-contamination test of a foil disk for a sample containing 2000 copies of the mecA gene. For further experimental and technical details refer to Lutz et al.(2009).
The original data (open access under CC BY-NC-ND license) were taken from Figure 3b by Lutz et al.(2009).
Poisot, T. (2011). The digitize Package: Extracting Numerical Data from Scatterplots. The R Journal 3, 25–26.
Lutz, S., Weber, P., Focke, M., Faltin, B., Roth, G., Piepenburg, O., Armes, N., Mark, D., Zengerle, R., and von Stetten, F. (2009). Isothermal Polymerase Amplification in a Centrifugal Microfluidic Foil Cartridge. Procedia Chemistry 1, 529–531.
data(RPA) plot(RPA, main = "RPA by Lutz et al.(2009)", xlab = "Reaction Time [min]", ylab = "Relative fluorescence units [RFU]", type = "l") abline(h = 5, lty = 2, col = "grey")data(RPA) plot(RPA, main = "RPA by Lutz et al.(2009)", xlab = "Reaction Time [min]", ylab = "Relative fluorescence units [RFU]", type = "l") abline(h = 5, lty = 2, col = "grey")
Smoother is a wrapper for several smoothing functions including LOWESS, Moving Average, Friedman's SuperSmoother, Cubic Spline and Savitzky-Golay smoothing filter, Friedman's SuperSmoother, and Whittaker smoother for amplification curve data.
## S4 method for signature 'numeric,numeric' smoother(x, y, trans = FALSE, bg.outliers = FALSE, method = "savgol", CPP = TRUE, paralell = NULL) ## S4 method for signature 'matrix,missing' smoother(x, y, trans = FALSE, bg.outliers = FALSE, method = "savgol", CPP = TRUE, paralell = NULL) ## S4 method for signature 'data.frame,missing' smoother(x, y, trans = FALSE, bg.outliers = FALSE, method = "savgol", CPP = TRUE, paralell = NULL)## S4 method for signature 'numeric,numeric' smoother(x, y, trans = FALSE, bg.outliers = FALSE, method = "savgol", CPP = TRUE, paralell = NULL) ## S4 method for signature 'matrix,missing' smoother(x, y, trans = FALSE, bg.outliers = FALSE, method = "savgol", CPP = TRUE, paralell = NULL) ## S4 method for signature 'data.frame,missing' smoother(x, y, trans = FALSE, bg.outliers = FALSE, method = "savgol", CPP = TRUE, paralell = NULL)
x |
|
y |
|
trans |
perform a linear transformation based on the trend of the background range. |
bg.outliers |
logical parameter which indicates of outliers should be removed from background range. |
method |
a list where each element is character vector representing a smoothing method or a named list of additional arguments to a smoothing algorithm. See Examples section. The Savitzky-Golay smoothing filter is the default smoother. Use "lowess" for LOWESS smoother (locally-weighted polynomial regression, "mova" for moving average, "savgol" for Savitzky-Golay smoothing filter, "smooth" for cubic spline smooth, "spline" for standard cubic spline smooth, "supsmu" for Friedman's SuperSmoother, "whit1" for weighted Whittaker smoothing with a first order finite difference penalty, "whit2" for weighted Whittaker smoothing with a second order finite difference penalty or "all" for all implemented smoothing algorithms. Both upper and lower case names are accepted. |
CPP |
logical parameter which indicates if CPP (curve pre-processor) should be used. |
paralell |
should contain a cluster object, created by package |
Amplification curve data of experimental thermo-cyclers may deliver results
which are hard to interpret due to noise and scatter. For data presentation
it is often useful to smooth or filter the data prior to presentation.
Smoothing and filtering are different approaches with a similar outcome to
preprocess an input signal in order to make it available for an analysis
step. Filtering uses methods of signal processing. They take a data input
and apply a function to form an output. There are linear and non-linear
filters. The most common example of a linear filter is the the moving
average. A moving average filter replaces sequentially data points with the
average of the neighbor data points. The average is calculated from a
defined span ("window") of odd count (e.g., 3, 5). The average herein may
also refer to the median, the geometric or exponential mean. Smoothing in
contrast uses statistical approaches. Such approaches use for example local
regression models (e.g., least squares estimate) or cubic splines. Splines apply
non-parametric regression by local cubic polynomials between knot points. Other
examples for smoothers include Savitzky-Golay smoothing filter, Friedman's
SuperSmoother, and Whittaker smoother. Several methods were integrated in the
chipPCR package. A careful evaluation of this preprocessing step is of
high importance (Spiess et al. 2014).
smoother is a wrapper for smoother
functions and filters commonly used to process amplification curve data.
The smoother function was enhanced by functionality
of the fixNA and CPP
functions. The parameter "lowess" for LOWESS smoother (locally-weighted
polynomial regression) can be tuned by the parameters f and
iter (see lowess for details). The parameter
"mova" for moving average can be tuned by the parameter movaww.
movaww is the window size used for the moving average (see
filter for details). The parameter "savgol" for
Savitzky-Golay smoothing filter can be tuned by the parameter p and
n (see sgolayfilt for details). The parameter
"smooth" for cubic spline smooth can be tuned by the parameter df.fact.
A df.fact value of 1 will leave the raw data almost unaffected while a
value 0.5 will smooth the curve considerably. For further details refer to
the smooth.spline function. The parameter "spline" for
standard cubic spline smooth has currently no additional parameter. The
parameter "supsmu" for Friedman's SuperSmoother can be tuned by the
parameter span. For further details refer to the
supsmu function. The parameter "lambda" is used in
Weighted Whittaker smoothing.
Stefan Roediger, Michal Burdukiewicz
Roediger S, Boehm A, Schimke I. Surface Melting Curve Analysis with R. The R Journal 2013;5:37–53.
Spiess, A.-N., Deutschmann, C., Burdukiewicz, M., Himmelreich, R., Klat, K., Schierack, P., Roediger, S., 2014. Impact of Smoothing on Parameter Estimation in Quantitative DNA Amplification Experiments. Clinical Chemistry clinchem.2014.230656. doi:10.1373/clinchem.2014.230656
# Results of different smoothers. A in-silico amplification was performed # using the AmpSim function and different smoothers were applied. Optimally # all smoothers should give the same result (which is not the case)). # refMFI means referenced Mean Fluorescence Intensity # (Roediger et al. 2013) tmp <- AmpSim(cyc = 1:35, bl = 0) plot(tmp, main = "In-silico real-time PCR\n Effect of Smoother", xlab = "Cycles", ylab ="refMFI", ylim = c(0,1), pch = 20, type = "b", lwd = 2) legend(25, 0.8, c("Raw data", "savgol", "lowess", "mova 3", "mova 5", "smooth", "spline", "supsmu"), pch = 20, lwd = 2, col = c(1:8)) #else tmp.smooths <- smoother(tmp, method = list("savgol", "lowess", mova = list(movaww = 3), mova = list(movaww = 5), "smooth", "spline", "supsmu")) for (i in 1:ncol(tmp.smooths)) lines(tmp[, 1], tmp.smooths[, i], type = "b", pch = 20, lwd = 2, col = i + 1) par(fig = c(0.15,0.6,0.45,0.99), new = TRUE) plot(tmp, main = "", xlab = "Cycles", ylab ="refMFI", pch = 20, xlim = c(14,20), ylim = c(0,0.45)) for (i in 1:ncol(tmp.smooths)) lines(tmp[, 1], tmp.smooths[, i], type = "b", pch = 20, lwd = 2, col = i + 1) # Plot the difference of the smoothed / filtered data # to the raw data against the cycles # The largest error is in the transition phases between # start and end of the detectable amplification process. par(fig = c(0,1,0,0.65)) plot(NA, NA, type = "b", col = 2, pch = 20, xlim = c(1,35), ylim = c(-0.1,0.1), xlab = "Cycle", ylab = "delta refMFI (raw - smoothed)", main = "Smoothed / Filtered data") legend(1.5, 0.1, ncol = 2, c("savgol", "lowess", "mova 3", "mova 5", "smooth", "spline", "supsmu"), pch = 20, lwd = 2, col = c(2:8)) for (i in 1:ncol(tmp.smooths)) lines(tmp[, 1], tmp[, 2] - tmp.smooths[, i], type = "b", pch = 20, lwd = 2, col = i + 1) par(fig = c(0,1,0.55,1), new = TRUE) plot(tmp, type = "b", col = 1, pch = 20, xlab = "", ylab = "RFU", main = "Raw data") #different ways of using smoother #1. single method single.smooth <- smoother(tmp, method = list("mova")) #single smooth, additional argument specified single.smooth.add <- smoother(tmp, method = list(mova = list(movaww = 3))) #3. more than one smoothing method, no additional arguments specified double.smooth <- smoother(tmp, method = list("savgol", "mova")) #4. more than one smoothing method, additional arguments specified double.smooth.add <- smoother(tmp, method = list("savgol", mova = list(movaww = 3))) #5. all smoothing methods, no additional arguments specified all.smooth <- smoother(tmp, method = list("all"))# Results of different smoothers. A in-silico amplification was performed # using the AmpSim function and different smoothers were applied. Optimally # all smoothers should give the same result (which is not the case)). # refMFI means referenced Mean Fluorescence Intensity # (Roediger et al. 2013) tmp <- AmpSim(cyc = 1:35, bl = 0) plot(tmp, main = "In-silico real-time PCR\n Effect of Smoother", xlab = "Cycles", ylab ="refMFI", ylim = c(0,1), pch = 20, type = "b", lwd = 2) legend(25, 0.8, c("Raw data", "savgol", "lowess", "mova 3", "mova 5", "smooth", "spline", "supsmu"), pch = 20, lwd = 2, col = c(1:8)) #else tmp.smooths <- smoother(tmp, method = list("savgol", "lowess", mova = list(movaww = 3), mova = list(movaww = 5), "smooth", "spline", "supsmu")) for (i in 1:ncol(tmp.smooths)) lines(tmp[, 1], tmp.smooths[, i], type = "b", pch = 20, lwd = 2, col = i + 1) par(fig = c(0.15,0.6,0.45,0.99), new = TRUE) plot(tmp, main = "", xlab = "Cycles", ylab ="refMFI", pch = 20, xlim = c(14,20), ylim = c(0,0.45)) for (i in 1:ncol(tmp.smooths)) lines(tmp[, 1], tmp.smooths[, i], type = "b", pch = 20, lwd = 2, col = i + 1) # Plot the difference of the smoothed / filtered data # to the raw data against the cycles # The largest error is in the transition phases between # start and end of the detectable amplification process. par(fig = c(0,1,0,0.65)) plot(NA, NA, type = "b", col = 2, pch = 20, xlim = c(1,35), ylim = c(-0.1,0.1), xlab = "Cycle", ylab = "delta refMFI (raw - smoothed)", main = "Smoothed / Filtered data") legend(1.5, 0.1, ncol = 2, c("savgol", "lowess", "mova 3", "mova 5", "smooth", "spline", "supsmu"), pch = 20, lwd = 2, col = c(2:8)) for (i in 1:ncol(tmp.smooths)) lines(tmp[, 1], tmp[, 2] - tmp.smooths[, i], type = "b", pch = 20, lwd = 2, col = i + 1) par(fig = c(0,1,0.55,1), new = TRUE) plot(tmp, type = "b", col = 1, pch = 20, xlab = "", ylab = "RFU", main = "Raw data") #different ways of using smoother #1. single method single.smooth <- smoother(tmp, method = list("mova")) #single smooth, additional argument specified single.smooth.add <- smoother(tmp, method = list(mova = list(movaww = 3))) #3. more than one smoothing method, no additional arguments specified double.smooth <- smoother(tmp, method = list("savgol", "mova")) #4. more than one smoothing method, additional arguments specified double.smooth.add <- smoother(tmp, method = list("savgol", mova = list(movaww = 3))) #5. all smoothing methods, no additional arguments specified all.smooth <- smoother(tmp, method = list("all"))
bg objects
Summarize bg objects and easily access results of
bg function.
## S4 method for signature 'bg' summary(object, print = TRUE)## S4 method for signature 'bg' summary(object, print = TRUE)
object |
is a |
print |
is a |
Stefan Roediger, Michal Burdukiewicz
res <- AmpSim(cyc = 1:40, Cq = 25) background <- bg.max(res[, 1], res[, 2]) #just print summary summary(background) #assign summary to variable without printing vals <- summary(background, print = FALSE) print(vals) #easily access different values vals["FDM"]res <- AmpSim(cyc = 1:40, Cq = 25) background <- bg.max(res[, 1], res[, 2]) #just print summary summary(background) #assign summary to variable without printing vals <- summary(background, print = FALSE) print(vals) #easily access different values vals["FDM"]
der objects
Summarize der objects and easily access results of
inder
function.
## S4 method for signature 'der' summary(object, digits = getOption("digits") - 3, print = TRUE)## S4 method for signature 'der' summary(object, digits = getOption("digits") - 3, print = TRUE)
object |
is a |
digits |
is a |
print |
is a |
The approximate second derivative maximum (SDM) which is commonly used to quantify quantitative real-time PCR experiments. The SDM might also be useful for isothermal amplification processes. The SDM is calculated from a derived cubic spline. Similarly the first approximate approximate derivative maximum (FDM), second derivative minimum (SDm), and approximate second derivative center (SDC, geometric mean of SDM and SDm) are available. FDM, SDm and SDC values can be used to further characterize the amplification process.
A named vector of four elements. The element named 2nd_der contains
values of the second first derivative. The element named SDM
contains approximate second derivative maximum, SDm contains
approximate second derivative minimum, and SDC contains approximate
second derivative center.
Stefan Roediger, Michal Burdukiewicz
Ruijter JM, Pfaffl MW, Zhao S, et al. (2013) Evaluation of qPCR curve analysis methods for reliable biomarker discovery: bias, resolution, precision, and implications. Methods San Diego Calif 59:32–46.
res <- AmpSim(cyc = 1:40, Cq = 25) test.der <- inder(res) #just print summary summary(test.der) #print without rounding summary(test.der, digits = 6) #assign summary to variable without printing and vals <- summary(test.der, print = FALSE) print(vals) #easily access different values vals["bg.start"]res <- AmpSim(cyc = 1:40, Cq = 25) test.der <- inder(res) #just print summary summary(test.der) #print without rounding summary(test.der, digits = 6) #assign summary to variable without printing and vals <- summary(test.der, print = FALSE) print(vals) #easily access different values vals["bg.start"]
refMFI objects
Summarize refMFI objects and access general statistics
of amplification reaction. refMFI means referenced Mean Fluorescence
Intensity (Roediger et al. 2013).
## S4 method for signature 'refMFI' summary(object, digits = getOption("digits") - 3, print = TRUE)## S4 method for signature 'refMFI' summary(object, digits = getOption("digits") - 3, print = TRUE)
object |
is a |
digits |
is a |
print |
is a |
Stefan Roediger, Michal Burdukiewicz
Roediger S, Boehm A, Schimke I. Surface Melting Curve Analysis with R. The R Journal 2013;5:37–53.
res <- AmpSim(cyc = 1:50, Cq = 41) summary(inder(res), print = TRUE)res <- AmpSim(cyc = 1:50, Cq = 41) summary(inder(res), print = TRUE)
"th"
An S4 class containing the output th.cyc
function.
.Data:"matrix" is a matrix containing the
threshold cycle and threshold fluorescence.
stats:"summary.lm" contains linear model used for Ct estimation.
input:"matrix" input data for linear model.
signature(object = "th"): prints summary
of the object.
signature(object = "th"): prints only
.Data slot of the object.
Stefan Roediger, Michal Burdukiewicz
res <- th.cyc(VIMCFX96_69[, 1], VIMCFX96_69[, 3], r = 2300) summary(res) slot(res, "input")res <- th.cyc(VIMCFX96_69[, 1], VIMCFX96_69[, 3], r = 2300) summary(res) slot(res, "input")
th.cyc calculates the number of cycles at which the
fluorescence exceeds a defined threshold, called the threshold cycle (Ct).
According to the MIQE guidelines the Ct is referred to as quantification
cycle (Cq). The calculated Cq is a relative value, which depends on the
template copy number, instrument, reagents, amplification efficiency and
probe technology. Low Cqs correlate with high quantities template copy
numbers. Real-time technologies enable the quantification of nucleic acids
by calculation of specific curve parameters like the quantification point
(Cq) and the amplification efficiency (AE) based on the kinetics of the
amplification curve. The Cq represents the number of cycles (time for qIA)
needed to reach a defined fluorescence signal level in the exponential
phase of the amplification curve. The Cq can be determined from a fixed
threshold value or by various analytical algorithm as described elsewhere
(Bustin et al. 2009, Ruijter et al. 2013, Tellinghuisen et al. 2014).
th.cyc(x, y, r = 2500, auto = FALSE, linear = TRUE)th.cyc(x, y, r = 2500, auto = FALSE, linear = TRUE)
x |
is a vector containing the time or cycle values. |
y |
is a vector containing the fluorescence values. |
r |
a fluorescence value which defines the threshold. |
auto |
is logical parameter which indicates if an automatic estimation of the threshold should be used (Note: Experimental, not safe to use). |
linear |
is logical parameter which indicates if a linear or quadratic regression should be used for the calculation. (Note: Experimental, not safe to use). |
The Threshold Cycle (Ct) (Cq according to MIQE, see Bustin et al. 2009) is
the cycle number at which the fluorescence exceeds significantly a point
above the baseline and defined threshold in a particular samples. Thus the
Ct is the cycle when sufficient numbers of amplicons have accumulated. The
th.cyc calculates the intersection of the user defined Ct value
(r) and a linear regression or quadratic polynomial in the range of
the user defined Ct value. In contrast to other methods,
th.cyc have no requirement to fit a "complex" non linear model to
the entire data set but rather focuses on the specific area. The polynomial
is calculated from four neighbor values at the fluorescence threshold.
An object of class th.
Stefan Roediger, Michal Burdukiewicz
Stephen A. Bustin, Vladimir Benes, Jeremy A. Garson, Jan Hellemans, Jim Huggett, Mikael Kubista, Reinhold Mueller, Tania Nolan, Michael W. Pfaffl, Gregory L. Shipley, Jo Vandesompele, and Carl T. Wittwer. (Apr 2009). "The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments". Clin Chem. 55 (4):611–22. doi:10.1373/clinchem.2008.112797. PMID 19246619
Ruijter, J.M., Pfaffl, M.W., Zhao, S., Spiess, A.N., Boggy, G., Blom, J., Rutledge, R.G., Sisti, D., Lievens, A., De Preter, K., Derveaux, S., Hellemans, J., Vandesompele, J.: Evaluation of qPCR curve analysis methods for reliable biomarker discovery: bias, resolution, precision, and implications. Methods (San Diego, Calif.) 59(1), 32–46 (2013). doi:10.1016/j.ymeth.2012.08.011. PMID: 22975077
Tellinghuisen, J., Spiess, A.-N.: Comparing real-time quantitative polymerase chain reaction analysis methods for precision, linearity, and accuracy of estimating amplification efficiency. Analytical Biochemistry 449, 76–82 (2014). doi:10.1016/j.ab.2013.12.020. PMID: 24365068
# First example # Raw data from the VIMCFX96_69 data set. # Cycles x <- VIMCFX96_69[, 1] # Fluoresce values y <- VIMCFX96_69[, 2] # Plot the raw data plot(x, y, xlab = "Cycle", ylab = "Fluo") # Calculate the the Ct value res <- th.cyc(x, y, r = 2300) lines(res@input, col = 2, lwd = 2) # Threshold fluorescence value abline(h = [email protected][2], col = 3) # Calculated Ct value abline(v = [email protected][1], col = 4) # Second example # Application of the th.cyc method to determine the Cq from a continous # amplification reaction. plot(NA, NA, xlim = c(0,80), ylim = c(0,1200), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR - Raw Data") # Threshold level "r" (50 micro Volts) for (i in c(1,3,5,7)) { y.tmp <- capillaryPCR[, i + 1] - mean(capillaryPCR[1L:150, i + 1]) Ct.tmp <- th.cyc(capillaryPCR[, i], y.tmp, r = 50, linear = FALSE) abline(v = Ct.tmp[1]) text(Ct.tmp[1] * 1.1, 1200, paste(round(Ct.tmp[1], 1), "\nmin")) lines(capillaryPCR[, i], y.tmp, type = "b", pch = 20 - i) points(Ct.tmp@input, col = "red", pch = 19) } abline(h = 50) legend(5,800, c("Run 1", "Run 2", "Run 3", "Control"), pch = c(19, 17, 15, 13), lwd = 1.5)# First example # Raw data from the VIMCFX96_69 data set. # Cycles x <- VIMCFX96_69[, 1] # Fluoresce values y <- VIMCFX96_69[, 2] # Plot the raw data plot(x, y, xlab = "Cycle", ylab = "Fluo") # Calculate the the Ct value res <- th.cyc(x, y, r = 2300) lines(res@input, col = 2, lwd = 2) # Threshold fluorescence value abline(h = res@.Data[2], col = 3) # Calculated Ct value abline(v = res@.Data[1], col = 4) # Second example # Application of the th.cyc method to determine the Cq from a continous # amplification reaction. plot(NA, NA, xlim = c(0,80), ylim = c(0,1200), xlab = "Time [min]", ylab = "Voltage [micro V]", main = "ccPCR - Raw Data") # Threshold level "r" (50 micro Volts) for (i in c(1,3,5,7)) { y.tmp <- capillaryPCR[, i + 1] - mean(capillaryPCR[1L:150, i + 1]) Ct.tmp <- th.cyc(capillaryPCR[, i], y.tmp, r = 50, linear = FALSE) abline(v = Ct.tmp[1]) text(Ct.tmp[1] * 1.1, 1200, paste(round(Ct.tmp[1], 1), "\nmin")) lines(capillaryPCR[, i], y.tmp, type = "b", pch = 20 - i) points(Ct.tmp@input, col = "red", pch = 19) } abline(h = 50) legend(5,800, c("Run 1", "Run 2", "Run 3", "Control"), pch = c(19, 17, 15, 13), lwd = 1.5)
Data set of an amplification reaction using the Bio-Rad CFX96 thermo cycler. The samples of Vimentin were amplified in the CFX96 as replicates according to Roediger et al. (2013). The quantification was performed during the annealing step (60 degrees Celsius).
data(VIMCFX96_60)data(VIMCFX96_60)
A data frame with 40 observations on the following 97 variables. The first column ("Cycle") contains the number of cycles and consecutive columns contain the replicates ("A1" to "H12").
Stefan Roediger, Claudia Deutschmann (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
data(VIMCFX96_60) data(VIMCFX96_69) T60 <- rowMeans(VIMCFX96_60[, 2:ncol(VIMCFX96_60)]) T69 <- rowMeans(VIMCFX96_69[, 2:ncol(VIMCFX96_69)]) plot(1:length(T60), T60, main = "Fluorescence at different temperatures\nQuantification in CFX96 (Bio-Rad)", xlab = "Cycle", ylab = "Cycle dependent fluorescence", pch = 15, type = "b") lines(1:length(T69), T69, pch = 19, type = "b", col = 2) legend(1, 4500, c("Annealing (60 deg C)", "Elongation (69 deg C)"), pch = c(15, 19), col = c(1,2))data(VIMCFX96_60) data(VIMCFX96_69) T60 <- rowMeans(VIMCFX96_60[, 2:ncol(VIMCFX96_60)]) T69 <- rowMeans(VIMCFX96_69[, 2:ncol(VIMCFX96_69)]) plot(1:length(T60), T60, main = "Fluorescence at different temperatures\nQuantification in CFX96 (Bio-Rad)", xlab = "Cycle", ylab = "Cycle dependent fluorescence", pch = 15, type = "b") lines(1:length(T69), T69, pch = 19, type = "b", col = 2) legend(1, 4500, c("Annealing (60 deg C)", "Elongation (69 deg C)"), pch = c(15, 19), col = c(1,2))
Data set of an amplification reaction using the Bio-Rad CFX96 thermo cycler. The samples of Vimentin were amplified in the CFX96 as replicates according to Roediger et al. (2013). The quantification was performed during the elongation step (69 degrees Celsius).
data(VIMCFX96_69)data(VIMCFX96_69)
A data frame with 40 observations on the following 97 variables. The first column ("Cycle") contains the number of cycles and consecutive columns contain the replicates ("A1" to "H12").
Stefan Roediger, Claudia Deutschmann (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
data(VIMCFX96_60) data(VIMCFX96_69) T60 <- rowMeans(VIMCFX96_60[, 2:ncol(VIMCFX96_60)]) T69 <- rowMeans(VIMCFX96_69[, 2:ncol(VIMCFX96_69)]) plot(1:length(T60), T60, main = "Fluorescence at different temperatures\nQuantification in CFX96 (Bio-Rad)", xlab = "Cycle", ylab = "Cycle dependent fluorescence", pch = 15, type = "b") lines(1:length(T69), T69, pch = 19, type = "b", col = 2) legend(1, 4500, c("Annealing (60 deg C)", "Elongation (69 deg C)"), pch = c(15, 19), col = c(1,2))data(VIMCFX96_60) data(VIMCFX96_69) T60 <- rowMeans(VIMCFX96_60[, 2:ncol(VIMCFX96_60)]) T69 <- rowMeans(VIMCFX96_69[, 2:ncol(VIMCFX96_69)]) plot(1:length(T60), T60, main = "Fluorescence at different temperatures\nQuantification in CFX96 (Bio-Rad)", xlab = "Cycle", ylab = "Cycle dependent fluorescence", pch = 15, type = "b") lines(1:length(T69), T69, pch = 19, type = "b", col = 2) legend(1, 4500, c("Annealing (60 deg C)", "Elongation (69 deg C)"), pch = c(15, 19), col = c(1,2))
Data set of a melting curve using the Bio-Rad CFX96 thermo cycler. The samples of Vimentin were measured in the CFX96 as replicates according to Roediger et al. (2013). The quantification was performed during the gradient from 55 to 95 degrees Celsius with a resolution of 0.5 degrees Celsius per step.
data(VIMCFX96_meltcurve)data(VIMCFX96_meltcurve)
A data frame with 81 observations on the following 97 variables. The first column ("Temperature") contains the temperature and consecutive columns contain the replicates ("A1" to "H12").
Stefan Roediger, Claudia Deutschmann (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
data(VIMCFX96_meltcurve) tmp <- VIMCFX96_meltcurve plot(NA, NA, xlim = c(55,95), ylim = c(2000, 7000), xlab = "Temperature (degrees Celsius)", ylab = "RFU", main = "Melting curve in CFX96 (Bio-Rad)") apply(tmp[, 2:ncol(tmp)], 2, function(x) lines(tmp[1:nrow(tmp),1],x)) Fmean <- rowMeans(tmp[, 2:ncol(tmp)]) lines(tmp[1:nrow(tmp),1], Fmean, col = "red", lwd = 3) legend(55, 4000, c("Raw", "Mean"), pch = c(19,19), col = c(1,2))data(VIMCFX96_meltcurve) tmp <- VIMCFX96_meltcurve plot(NA, NA, xlim = c(55,95), ylim = c(2000, 7000), xlab = "Temperature (degrees Celsius)", ylab = "RFU", main = "Melting curve in CFX96 (Bio-Rad)") apply(tmp[, 2:ncol(tmp)], 2, function(x) lines(tmp[1:nrow(tmp),1],x)) Fmean <- rowMeans(tmp[, 2:ncol(tmp)]) lines(tmp[1:nrow(tmp),1], Fmean, col = "red", lwd = 3) legend(55, 4000, c("Raw", "Mean"), pch = c(19,19), col = c(1,2))
Data set of an amplification reaction using the Bio-Rad iQ5 thermo cycler. The samples of Vimentin were amplified in the iQ5 as replicates according to Roediger et al. (2013). The quantification was performed during the annealing step (59.5 degrees Celsius).
data(VIMiQ5_595)data(VIMiQ5_595)
A data frame with 40 observations on the following 97 variables. The first column ("Cycles") contains the number of cycles and consecutive columns contain the replicates ("A01" to "H12").
Stefan Roediger, Claudia Deutschmann (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
T595 <- rowMeans(VIMiQ5_595[, 2:ncol(VIMiQ5_595)]) T685 <- rowMeans(VIMiQ5_685[, 2:ncol(VIMiQ5_685)]) plot(1:length(T595), T595, main = "Fluorescence at different temperatures\nQuantification in iQ5 (Bio-Rad)", xlab = "Cycle", ylab = "Cycle dependent fluorescence", pch = 15, type = "b") lines(1:length(T685), T685, pch = 19, type = "b", col = 2) legend(1, 10000, c("Annealing (59.5 deg C)", "Elongation (68.5 deg C)"), pch = c(15, 19), col = c(1,2))T595 <- rowMeans(VIMiQ5_595[, 2:ncol(VIMiQ5_595)]) T685 <- rowMeans(VIMiQ5_685[, 2:ncol(VIMiQ5_685)]) plot(1:length(T595), T595, main = "Fluorescence at different temperatures\nQuantification in iQ5 (Bio-Rad)", xlab = "Cycle", ylab = "Cycle dependent fluorescence", pch = 15, type = "b") lines(1:length(T685), T685, pch = 19, type = "b", col = 2) legend(1, 10000, c("Annealing (59.5 deg C)", "Elongation (68.5 deg C)"), pch = c(15, 19), col = c(1,2))
Data set of an amplification reaction using the Bio-Rad iQ5 thermo cycler. The samples of Vimentin were amplified in the iQ5 as replicates according to Roediger et al. (2013). The quantification was performed during the elongation step (68.5 degrees Celsius).
data(VIMiQ5_685)data(VIMiQ5_685)
A data frame with 40 observations on the following 97 variables. The first column ("Cycles") contains the number of cycles and consecutive columns contain the replicates ("A01" to "H12").
Stefan Roediger, Claudia Deutschmann (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
T595 <- rowMeans(VIMiQ5_595[, 2:ncol(VIMiQ5_595)]) T685 <- rowMeans(VIMiQ5_685[, 2:ncol(VIMiQ5_685)]) plot(1:length(T595), T595, main = "Fluorescence at different temperatures\nQuantification in iQ5 (Bio-Rad)", xlab = "Cycle", ylab = "Cycle dependent fluorescence", pch = 15, type = "b") lines(1:length(T685), T685, pch = 19, type = "b", col = 2) legend(1, 10000, c("Annealing (59.5 deg C)", "Elongation (68.5 deg C)"), pch = c(15, 19), col = c(1,2))T595 <- rowMeans(VIMiQ5_595[, 2:ncol(VIMiQ5_595)]) T685 <- rowMeans(VIMiQ5_685[, 2:ncol(VIMiQ5_685)]) plot(1:length(T595), T595, main = "Fluorescence at different temperatures\nQuantification in iQ5 (Bio-Rad)", xlab = "Cycle", ylab = "Cycle dependent fluorescence", pch = 15, type = "b") lines(1:length(T685), T685, pch = 19, type = "b", col = 2) legend(1, 10000, c("Annealing (59.5 deg C)", "Elongation (68.5 deg C)"), pch = c(15, 19), col = c(1,2))
Data set of a melting curve using the Bio-Rad iQ5 thermo cycler. The samples of Vimentin were measured in the CFX96 as replicates according to Roediger et al. (2013). The quantification was performed during the gradient from 55 to 95 degrees Celsius with a resolution of 0.5 degrees Celsius per step.
data(VIMiQ5_melt)data(VIMiQ5_melt)
A data frame with 81 observations on the following 97 variables. The first column ("T") contains the temperature and consecutive columns contain the replicates ("A01" to "H12").
Stefan Roediger, Claudia Deutschmann (BTU Cottbus - Senftenberg)
A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33–74, 2013.
data(VIMiQ5_melt) tmp <- VIMiQ5_melt plot(NA, NA, xlim = c(55,95), ylim = c(0, 40000), xlab = "Temperature (degrees Celsius)",ylab = "RFU", main = "Melting curve in iQ5 (Bio-Rad)") apply(tmp[, 2:ncol(tmp)], 2, function(x) lines(tmp[1:nrow(tmp),1],x)) Fmean <- rowMeans(tmp[, 2:ncol(tmp)]) lines(tmp[1:nrow(tmp),1], Fmean, col = "red", lwd = 3) legend(55, 4000, c("Raw", "Mean"), pch = c(19,19), col = c(1,2))data(VIMiQ5_melt) tmp <- VIMiQ5_melt plot(NA, NA, xlim = c(55,95), ylim = c(0, 40000), xlab = "Temperature (degrees Celsius)",ylab = "RFU", main = "Melting curve in iQ5 (Bio-Rad)") apply(tmp[, 2:ncol(tmp)], 2, function(x) lines(tmp[1:nrow(tmp),1],x)) Fmean <- rowMeans(tmp[, 2:ncol(tmp)]) lines(tmp[1:nrow(tmp),1], Fmean, col = "red", lwd = 3) legend(55, 4000, c("Raw", "Mean"), pch = c(19,19), col = c(1,2))